Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERGEF cdna clone

SERGEF cDNA Clone

Gene Names
SERGEF; Gnefr; DELGEF
Synonyms
SERGEF; SERGEF cDNA Clone; SERGEF cdna clone
Ordering
For Research Use Only!
Sequence
atggagcgcgagcccagcgcctcggaggccgcccccgcggcggccgcgctcttcgcctggggtgcaaatagctatgggcaacttggcctcggccataaggaagatgtgctgttgccccagcaactgaatgacttctgtaaacccaggagtgtcaggaggatcacaggaggagggggccactctgcagttgtcacagatggaggagacctctttgtttgtggcctgaacaaagatgggcaactggggcttggtcacacagaggatatcccatattttaccccctgcaaatccctctttggctgtcccatccaacaggtggcctgtggctgggattttacgattatgctcacagaaaatggtcaagttctatcatgtggatccaactcctttggccagttaggagttcctcatggacctcgaagatgtgtggttccccaggccattgagctccataaagagaaggttgtttgtattgctgctggactgaggcatgcagtagctgctacagcgagtggcatcgtgttccagtgggggactggtttggcatcatgtggacgacggttgtgccctgggcagactcttccattgtttttcacagcaaaggaaccaagcagagtgacaggtctagagaattctaaagcaatgtgtgttcttgctggctcagaccactcagcttcattaacagatgcaggagaggtgtatgtttggggaagcaacaagcatgggcaactggctaatgaggctgctttccttcctgtgccccagaaaatagaagcacattgtttccagaatgaaaaggtcactgccatctggagtggatggacacacctggttgctcagacagaaactggcaagatgtttacctggggccgagcagactatggtcagctagggaggaagttggagacttatgaaggctggaaactagaaaagcaagattcatttctcccctgttcaagaccaccgaacagcatgccttcgtctccgcattgcttaactggagcaactgaggtctcttgtggctcagagcataatttggcaataattggtggagtgtgttactcttggggctggaatgagcatggcatgtgcggagatggcactgaagccaacgtctgggccccaaagccggtgcaggctctgctgtcatcgtcaggactccttgtgggctgtggggctggccactccttggccctctgccagctgccagctcaccctgcattggtccaggaccccaaggtcacctacctttccccagatgccatcgaggacactgaatctcagaaagccatggacaaagagagaaactggaaggaaagacaatcagaaacttcaacccaaagccaatctgactggtccagaaatgggggactgtga
Sequence Length
1377
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,566 Da
NCBI Official Full Name
Homo sapiens secretion regulating guanine nucleotide exchange factor, mRNA
NCBI Official Synonym Full Names
secretion regulating guanine nucleotide exchange factor
NCBI Official Symbol
SERGEF
NCBI Official Synonym Symbols
Gnefr; DELGEF
NCBI Protein Information
secretion-regulating guanine nucleotide exchange factor
UniProt Protein Name
Secretion-regulating guanine nucleotide exchange factor
UniProt Gene Name
SERGEF
UniProt Synonym Gene Names
DELGEF; GNEFR; DelGEF
UniProt Entry Name
SRGEF_HUMAN

Uniprot Description

SERGEF: Probable guanine nucleotide exchange factor (GEF), which may be involved in the secretion process. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: GEFs, Ras; GEFs

Chromosomal Location of Human Ortholog: 11p14.3

Cellular Component: cytoplasm; nucleus

Molecular Function: protein binding; Ran guanyl-nucleotide exchange factor activity

Biological Process: negative regulation of protein secretion; signal transduction

Research Articles on SERGEF

Similar Products

Product Notes

The SERGEF sergef (Catalog #AAA1278641) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcgcg agcccagcgc ctcggaggcc gcccccgcgg cggccgcgct cttcgcctgg ggtgcaaata gctatgggca acttggcctc ggccataagg aagatgtgct gttgccccag caactgaatg acttctgtaa acccaggagt gtcaggagga tcacaggagg agggggccac tctgcagttg tcacagatgg aggagacctc tttgtttgtg gcctgaacaa agatgggcaa ctggggcttg gtcacacaga ggatatccca tattttaccc cctgcaaatc cctctttggc tgtcccatcc aacaggtggc ctgtggctgg gattttacga ttatgctcac agaaaatggt caagttctat catgtggatc caactccttt ggccagttag gagttcctca tggacctcga agatgtgtgg ttccccaggc cattgagctc cataaagaga aggttgtttg tattgctgct ggactgaggc atgcagtagc tgctacagcg agtggcatcg tgttccagtg ggggactggt ttggcatcat gtggacgacg gttgtgccct gggcagactc ttccattgtt tttcacagca aaggaaccaa gcagagtgac aggtctagag aattctaaag caatgtgtgt tcttgctggc tcagaccact cagcttcatt aacagatgca ggagaggtgt atgtttgggg aagcaacaag catgggcaac tggctaatga ggctgctttc cttcctgtgc cccagaaaat agaagcacat tgtttccaga atgaaaaggt cactgccatc tggagtggat ggacacacct ggttgctcag acagaaactg gcaagatgtt tacctggggc cgagcagact atggtcagct agggaggaag ttggagactt atgaaggctg gaaactagaa aagcaagatt catttctccc ctgttcaaga ccaccgaaca gcatgccttc gtctccgcat tgcttaactg gagcaactga ggtctcttgt ggctcagagc ataatttggc aataattggt ggagtgtgtt actcttgggg ctggaatgag catggcatgt gcggagatgg cactgaagcc aacgtctggg ccccaaagcc ggtgcaggct ctgctgtcat cgtcaggact ccttgtgggc tgtggggctg gccactcctt ggccctctgc cagctgccag ctcaccctgc attggtccag gaccccaagg tcacctacct ttccccagat gccatcgagg acactgaatc tcagaaagcc atggacaaag agagaaactg gaaggaaaga caatcagaaa cttcaaccca aagccaatct gactggtcca gaaatggggg actgtga. It is sometimes possible for the material contained within the vial of "SERGEF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.