SERBP1 cdna clone
SERBP1 cDNA Clone
Gene Names
SERBP1; CGI-55; CHD3IP; HABP4L; PAIRBP1; PAI-RBP1
Synonyms
SERBP1; SERBP1 cDNA Clone; SERBP1 cdna clone
Sequence
atgcctgggcacttacaggaaggcttcggctgcgtggtcaccaaccgattcgaccagttatttgacgacgaatcggaccccttcgaggtgctgaaggcagcagagaacaagaaaaaagaagccggcgggggcggcgttgggggccctggggccaagagcgcagctcaggccgcggcccagaccaactccaacgcggcaggcaaacagctgcgcaaggagtcccagaaagaccgcaagaacccgctgccccccagcgttggcgtggttgacaagaaagaggagacgcagccgcccgtggcgcttaagaaagaaggaataagacgagttggaagaagacctgatcaacaacttcagggtgaagggaaaataattgatagaagaccagaaaggcgaccacctcgtgaacgaagattcgaaaagccacttgaagaaaagggtgaaggaggcgaattttcagttgatagaccgattattgaccgacctattcgaggtcgtggtggtcttggaagaggtcgagggggccgtggacgtggaatgggccgaggagatggatttgattctcgtggcaaacgtgaatttgataggcatagtggaagtgatagatctggcctgaagcacgaggacaaacgtggaggtagcggatctcacaactggggaactgtcaaagacgaattaactgacttggatcaatcaaatgtgactgaggaaacacctgaaggtgaagaacatcatccagtggcagacactgaaaataaggagaatgaagttgaagaggtaaaagaggagggtccaaaagagatgactttggatgagtggaaggctattcaaaataaggaccgggcaaaagtagaatttaatatccgaaaaccaaatgaaggtgctgatgggcagtggaagaagggatttgttcttcataaatcaaagagtgaagaggctcatgctgaagattcggttatggaccatcatttccggaagccagcaaatgatataacgtctcagctggagatcaattttggagaccttggccgcccaggacgtggcggcaggggaggacgaggtggacgtgggcgtggtgggcgcccaaaccgtggcagcaggaccgacaagtcaagtgcttctgctcctgatgtggatgacccagaggcattcccagctctggcttaa
Sequence Length
1164
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
42,427 Da
NCBI Official Full Name
Homo sapiens SERPINE1 mRNA binding protein 1, mRNA
NCBI Official Synonym Full Names
SERPINE1 mRNA binding protein 1
NCBI Official Symbol
SERBP1
NCBI Official Synonym Symbols
CGI-55; CHD3IP; HABP4L; PAIRBP1; PAI-RBP1
NCBI Protein Information
plasminogen activator inhibitor 1 RNA-binding protein
UniProt Protein Name
Plasminogen activator inhibitor 1 RNA-binding protein
Protein Family
UniProt Gene Name
SERBP1
UniProt Synonym Gene Names
PAIRBP1; PAI-RBP1
UniProt Entry Name
PAIRB_HUMAN
Uniprot Description
PAI-RBP1: a predicted RNA-binding protein. May specifically binds the mRNA of type-1 plasminogen activator inhibitor (PAI-1), and is thought to be involved in regulation of mRNA stability. A related rat protein RDA288 plays a significant role in mediating the anti-apoptotic action of progesterone in granulosa cells.
Protein type: RNA-binding
Chromosomal Location of Human Ortholog: 1p31
Cellular Component: cell-cell adherens junction; cytoplasm; membrane
Molecular Function: mRNA 3'-UTR binding; protein binding
Research Articles on SERBP1
Similar Products
Product Notes
The SERBP1 serbp1 (Catalog #AAA1272109) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgggc acttacagga aggcttcggc tgcgtggtca ccaaccgatt cgaccagtta tttgacgacg aatcggaccc cttcgaggtg ctgaaggcag cagagaacaa gaaaaaagaa gccggcgggg gcggcgttgg gggccctggg gccaagagcg cagctcaggc cgcggcccag accaactcca acgcggcagg caaacagctg cgcaaggagt cccagaaaga ccgcaagaac ccgctgcccc ccagcgttgg cgtggttgac aagaaagagg agacgcagcc gcccgtggcg cttaagaaag aaggaataag acgagttgga agaagacctg atcaacaact tcagggtgaa gggaaaataa ttgatagaag accagaaagg cgaccacctc gtgaacgaag attcgaaaag ccacttgaag aaaagggtga aggaggcgaa ttttcagttg atagaccgat tattgaccga cctattcgag gtcgtggtgg tcttggaaga ggtcgagggg gccgtggacg tggaatgggc cgaggagatg gatttgattc tcgtggcaaa cgtgaatttg ataggcatag tggaagtgat agatctggcc tgaagcacga ggacaaacgt ggaggtagcg gatctcacaa ctggggaact gtcaaagacg aattaactga cttggatcaa tcaaatgtga ctgaggaaac acctgaaggt gaagaacatc atccagtggc agacactgaa aataaggaga atgaagttga agaggtaaaa gaggagggtc caaaagagat gactttggat gagtggaagg ctattcaaaa taaggaccgg gcaaaagtag aatttaatat ccgaaaacca aatgaaggtg ctgatgggca gtggaagaag ggatttgttc ttcataaatc aaagagtgaa gaggctcatg ctgaagattc ggttatggac catcatttcc ggaagccagc aaatgatata acgtctcagc tggagatcaa ttttggagac cttggccgcc caggacgtgg cggcagggga ggacgaggtg gacgtgggcg tggtgggcgc ccaaaccgtg gcagcaggac cgacaagtca agtgcttctg ctcctgatgt ggatgaccca gaggcattcc cagctctggc ttaa. It is sometimes possible for the material contained within the vial of "SERBP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
