SENP8 cdna clone
SENP8 cDNA Clone
Gene Names
SENP8; DEN1; NEDP1; PRSC2
Synonyms
SENP8; SENP8 cDNA Clone; SENP8 cdna clone
Sequence
atggaccccgtagtcttgagttacatggacagtctactgcggcaatcagatgtctcactattggatccgccaagctggctcaatgaccatattattgggtttgcgtttgagtactttgccaacagtcagtttcatgactgctctgatcacgtcagtttcatcagccctgaagtcacccagttcatcaagtgcactagcaacccagcagagattgccatgttccttgaaccactggacctccccaacaagagagttgtatttttagccatcaatgataactccaaccaggcagctggaggaacccactggagtttattggtctacctccaagataaaaatagcttttttcattatgattcccatagcaggagcaactcagttcacgcaaagcaggtagcagagaaactggaggctttcttaggcagaaaaggagacaaactggcctttgtggaagagaaagcccctgcccaacaaaacagctatgactgtgggatgtacgtgatatgtaacactgaggccttgtgtcagaacttctttaggcaacagacagaatcactgctgcagctactcacccctgcatacatcacaaagaagaggggagaatggaaagatctcattgccacacttgctaaaaagtag
Sequence Length
639
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
24,107 Da
NCBI Official Full Name
Homo sapiens SUMO/sentrin specific peptidase family member 8, mRNA
NCBI Official Synonym Full Names
SUMO/sentrin peptidase family member, NEDD8 specific
NCBI Official Symbol
SENP8
NCBI Official Synonym Symbols
DEN1; NEDP1; PRSC2
NCBI Protein Information
sentrin-specific protease 8
UniProt Protein Name
Sentrin-specific protease 8
Protein Family
UniProt Gene Name
SENP8
UniProt Synonym Gene Names
DEN1; NEDP1; PRSC2
UniProt Entry Name
SENP8_HUMAN
NCBI Description
This gene encodes a cysteine protease that is a member of the sentrin-specific protease family. The encoded protein is involved in processing and deconjugation of the ubiquitin-like protein termed, neural precursor cell expressed developmentally downregulated 8. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Uniprot Description
SENP8: Protease that catalyzes two essential functions in the NEDD8 pathway: processing of full-length NEDD8 to its mature form and deconjugation of NEDD8 from targeted proteins such as cullins or p53. Belongs to the peptidase C48 family.
Protein type: EC 3.4.22.68; Protease
Chromosomal Location of Human Ortholog: 15q23
Research Articles on SENP8
Similar Products
Product Notes
The SENP8 senp8 (Catalog #AAA1272030) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaccccg tagtcttgag ttacatggac agtctactgc ggcaatcaga tgtctcacta ttggatccgc caagctggct caatgaccat attattgggt ttgcgtttga gtactttgcc aacagtcagt ttcatgactg ctctgatcac gtcagtttca tcagccctga agtcacccag ttcatcaagt gcactagcaa cccagcagag attgccatgt tccttgaacc actggacctc cccaacaaga gagttgtatt tttagccatc aatgataact ccaaccaggc agctggagga acccactgga gtttattggt ctacctccaa gataaaaata gcttttttca ttatgattcc catagcagga gcaactcagt tcacgcaaag caggtagcag agaaactgga ggctttctta ggcagaaaag gagacaaact ggcctttgtg gaagagaaag cccctgccca acaaaacagc tatgactgtg ggatgtacgt gatatgtaac actgaggcct tgtgtcagaa cttctttagg caacagacag aatcactgct gcagctactc acccctgcat acatcacaaa gaagagggga gaatggaaag atctcattgc cacacttgct aaaaagtag. It is sometimes possible for the material contained within the vial of "SENP8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
