SENP2 cdna clone
SENP2 cDNA Clone
Gene Names
SENP2; AXAM2; SMT3IP2
Synonyms
SENP2; SENP2 cDNA Clone; SENP2 cdna clone
Sequence
atgtacagatggctggttaggattctcggcaccattttccgtttctgcgaccggtcggtgccccctgcccgggccctcctgaagaggcggcgctcagacagcactctgttttctacagtggacactgatgaaataccagccaaaagaccaagattagattgctttattcaccaagtgaaaaacagtctctacaatgctgccagcttatttggattcccattccagctgaccacaaagcccatggtaacttctgcttgtaatggaacacggaatgtggccccttcaggagaggtattttcgaactcttcatcttgtgaactgacaggttctggatcctggaacaacatgctgaaactgggtaataaatctcctaatggaataagtgactatccaaagatcagagtgacagttacccgagatcagccacgcagagtcctgccttcctttggttttactttgaactcagaaggctgtaatagaagaccaggtggccgtcgccatagcaaaggtaatccagagagttctttaatgtggaaacctcaggaacaggctgtaacagagatgatttctgaagagagtggcaagggtctgaggcgtccccattgtactgtggaggagggtgttcaaaaagaggaaagagagaagtaccgaaagttattggaacgacttaaagaaagtggtcatggaaactctgtctgtcctgtaacttcaaattatcacagttctcaaagaagtcagatggacacattaaagaccaaaggctggggggaagagcaaaatcacggagtcaaaacaactcagtttgttccaaaacaatatagacttgttgaaacaaggggacctctatgttcattgagaagtgaaaagaggtgttcaaaggggaaaattactgatacagagacgatggtcggaatcagatttgaaaatgaaagtaggaggggataccaactggagcctgacctatcagaagaagtgtcggcccgactccgcctgggcagtggaagcaatggcttactcaggaggaaagtgtcaataattgagacaaaggaaaagaattgctcaggcaaagagagggacagaagaacggacgatctccttgaacttacagaggacatggaaaaggaaatcagtaatgccctaggccatggcccacaggatgaaatcctaagtagtgctttcaaattgcgaattactcgaggagatattcagacattaaagaactatcactggctcaatgatgaagtcattaatttttacatgaatcttctggtggaaagaaataaaaagcaaggctatccagcacttcatgtattcagtactttcttctatcctaaattaaagtctgggggttaccaagcagtgaaacgatggaccaaaggggtaaatctctttgaacaagaaattattctggtgcctattcatcggaaggtacattggagcctggtggtgattgacctaagaaaaaagtgtcttaaatatctggattctatgggacaaaagggccacaggatctgtgagattctccttcagtatttacaggatgaaagtaagaccaaaagaaatagtgatctgaatcttttagagtggacccatcacagcatgaaaccacacgagattcctcaacagctgaatgggagtgattgtggaatgtttacttgtaaatatgcagattatatttctagggacaaacctatcacatttactcagcaccagatgcctctcttccggaagaagatggtgtgggaaatccttcatcagcagttgctgtga
Sequence Length
1770
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
66,358 Da
NCBI Official Full Name
Homo sapiens SUMO1/sentrin/SMT3 specific peptidase 2, mRNA
NCBI Official Synonym Full Names
SUMO1/sentrin/SMT3 specific peptidase 2
NCBI Official Symbol
SENP2
NCBI Official Synonym Symbols
AXAM2; SMT3IP2
NCBI Protein Information
sentrin-specific protease 2
UniProt Protein Name
Sentrin-specific protease 2
Protein Family
UniProt Gene Name
SENP2
UniProt Synonym Gene Names
KIAA1331; Smt3ip2
UniProt Entry Name
SENP2_HUMAN
NCBI Description
SUMO1 (UBL1; MIM 601912) is a small ubiquitin-like protein that can be covalently conjugated to other proteins. SENP2 is one of a group of enzymes that process newly synthesized SUMO1 into the conjugatable form and catalyze the deconjugation of SUMO1-containing species.[supplied by OMIM, Apr 2004]
Uniprot Description
SENP2: Protease that catalyzes two essential functions in the SUMO pathway: processing of full-length SUMO1, SUMO2 and SUMO3 to their mature forms and deconjugation of SUMO1, SUMO2 and SUMO3 from targeted proteins. May down-regulate CTNNB1 levels and thereby modulate the Wnt pathway. Belongs to the peptidase C48 family.
Protein type: EC 3.4.22.68; Protease
Chromosomal Location of Human Ortholog: 3q27.2
Cellular Component: nuclear pore; nucleoplasm; PML body
Molecular Function: endopeptidase activity; protein binding; SUMO-specific protease activity
Biological Process: fat cell differentiation; negative regulation of protein ubiquitination; positive regulation of protein ubiquitination; protein destabilization; protein desumoylation; protein sumoylation
Research Articles on SENP2
Similar Products
Product Notes
The SENP2 senp2 (Catalog #AAA1277993) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtacagat ggctggttag gattctcggc accattttcc gtttctgcga ccggtcggtg ccccctgccc gggccctcct gaagaggcgg cgctcagaca gcactctgtt ttctacagtg gacactgatg aaataccagc caaaagacca agattagatt gctttattca ccaagtgaaa aacagtctct acaatgctgc cagcttattt ggattcccat tccagctgac cacaaagccc atggtaactt ctgcttgtaa tggaacacgg aatgtggccc cttcaggaga ggtattttcg aactcttcat cttgtgaact gacaggttct ggatcctgga acaacatgct gaaactgggt aataaatctc ctaatggaat aagtgactat ccaaagatca gagtgacagt tacccgagat cagccacgca gagtcctgcc ttcctttggt tttactttga actcagaagg ctgtaataga agaccaggtg gccgtcgcca tagcaaaggt aatccagaga gttctttaat gtggaaacct caggaacagg ctgtaacaga gatgatttct gaagagagtg gcaagggtct gaggcgtccc cattgtactg tggaggaggg tgttcaaaaa gaggaaagag agaagtaccg aaagttattg gaacgactta aagaaagtgg tcatggaaac tctgtctgtc ctgtaacttc aaattatcac agttctcaaa gaagtcagat ggacacatta aagaccaaag gctgggggga agagcaaaat cacggagtca aaacaactca gtttgttcca aaacaatata gacttgttga aacaagggga cctctatgtt cattgagaag tgaaaagagg tgttcaaagg ggaaaattac tgatacagag acgatggtcg gaatcagatt tgaaaatgaa agtaggaggg gataccaact ggagcctgac ctatcagaag aagtgtcggc ccgactccgc ctgggcagtg gaagcaatgg cttactcagg aggaaagtgt caataattga gacaaaggaa aagaattgct caggcaaaga gagggacaga agaacggacg atctccttga acttacagag gacatggaaa aggaaatcag taatgcccta ggccatggcc cacaggatga aatcctaagt agtgctttca aattgcgaat tactcgagga gatattcaga cattaaagaa ctatcactgg ctcaatgatg aagtcattaa tttttacatg aatcttctgg tggaaagaaa taaaaagcaa ggctatccag cacttcatgt attcagtact ttcttctatc ctaaattaaa gtctgggggt taccaagcag tgaaacgatg gaccaaaggg gtaaatctct ttgaacaaga aattattctg gtgcctattc atcggaaggt acattggagc ctggtggtga ttgacctaag aaaaaagtgt cttaaatatc tggattctat gggacaaaag ggccacagga tctgtgagat tctccttcag tatttacagg atgaaagtaa gaccaaaaga aatagtgatc tgaatctttt agagtggacc catcacagca tgaaaccaca cgagattcct caacagctga atgggagtga ttgtggaatg tttacttgta aatatgcaga ttatatttct agggacaaac ctatcacatt tactcagcac cagatgcctc tcttccggaa gaagatggtg tgggaaatcc ttcatcagca gttgctgtga. It is sometimes possible for the material contained within the vial of "SENP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
