SEMA4F cdna clone
SEMA4F cDNA Clone
Gene Names
SEMA4F; S4F; SEMAM; SEMAW; M-SEMA; PRO2353; m-Sema-M
Synonyms
SEMA4F; SEMA4F cDNA Clone; SEMA4F cdna clone
Sequence
atgccggcctctgctgcgcggccccgcccgggtcccgggcagcctacagcctcgcccttcccgctactgctgctggcggtgctgagcggcccggtatccggccgcgtcccccgctcggtgcccagaacctcgcttccaatctctgaggctgactcctgtctcacccggttcgcagtccctcacacatacaattactctgttctccttgtggatcctgcctcccacacactttatgttggcgcccgggacaccatcttcgctttatccctgcccttctcaggggagagaccccgcaggattgactggatggttcctgaggctcacagacagaactgtaggaagaaaggcaagaaagagggggacctcgggggccggaagaccctccagcagagatggacgacgtttttgaaagctgacctgctctgtccagggcctgagcatggccgggcctccagtgtcctgcaggatgttgctgtgcttcgacctgagcttggggcagggactcccatcttttatggcatcttttcttcccagtgggagggggctactatctctgctgtctgtgccttccgaccacaagacattcggacagtgctgaatggtcccttcagagaactaaaacatgactgcaacagaggactgcctgtcgtggacaatgatgtgccccagcccagacctggagagtgcatcaccaacaacatgaagctccggcactttggctcatctctctccctgcctgaccgcgtactcaccttcatccgggaccacccactcatggacaggccagtgtttccagctgatggccaccccctgctggtcactacagatacagcctatctcagagtcgtggcccacagggtgaccagcctctcagggaaagagtatgatgtgctctacctggggacagaggatggacacctccaccgagcagtgcggatcggagctcagctcagcgttcttgaagatctggccttattcccagagccacagccagttgagaacatgaaattgtaccacagctggctcctggttggctcccgtactgaggtgacacaagtgaatacaaccaactgtggccgtctccagagctgctcagagtgcatcctggcccaggacccagtctgtgcctggagcttccggctggatgagtgtgtggcccatgccggggagcaccgagggttggtccaagacatagagtcagcagatgtctcctctttgtgtcctaaagagcctggagaacgtccagtagtgtttgaagttcccgtggctacagctgcgcatgtggtcttgccatgttctccaagctcagcatgggcatcctgtgtgtggcaccagcccagtggagtgactgcactcaccccccggcgggatggactggaggtggtggtgaccccaggggccatgggcgcttatgcctgtgaatgtcaggagggtggggcagcccatgtggtagcagcttacagcttggtatggggcagccagcgagatgctccgagccgggcccacacagtgggggcgggactggctggcttcttcttggggattctcgcagcatccctgactctcattctgattggtcggcgtcagcagcgacggcgacagagggaacttctggctagagacaaggtgggcctggacctgggggctccaccttctgggaccacaagctacagccaagaccctccctccccctctcctgaagatgagcggttgccgctggccctggccaagaggggcagtggctttggtggattctcaccacccttcctgcttgatccttgcccaagcccagcccacattcggctaactggggctcctctagccacatgtgatgaaacatccatctag
Sequence Length
1848
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
66,477 Da
NCBI Official Full Name
Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F, mRNA
NCBI Official Synonym Full Names
ssemaphorin 4F
NCBI Official Symbol
SEMA4F
NCBI Official Synonym Symbols
S4F; SEMAM; SEMAW; M-SEMA; PRO2353; m-Sema-M
NCBI Protein Information
semaphorin-4F
UniProt Protein Name
Semaphorin-4F
Protein Family
UniProt Gene Name
SEMA4F
UniProt Synonym Gene Names
SEMAM; SEMAW; Sema M; Sema W
UniProt Entry Name
SEM4F_HUMAN
NCBI Description
This gene encodes a transmembrane class IV semaphorin family protein, which plays a role in neural development. This gene may be involved in neurogenesis in prostate cancer, the development of neurofibromas, and breast cancer tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Uniprot Description
SEMA4F: a single-pass type I membrane protein that may play a role in axon guidance.
Protein type: Membrane protein, integral; Cell adhesion
Chromosomal Location of Human Ortholog: 2p13.1
Cellular Component: endoplasmic reticulum; extracellular space; integral to plasma membrane; membrane; plasma membrane
Molecular Function: chemorepellent activity; semaphorin receptor binding
Biological Process: axon guidance; cell-cell signaling; negative chemotaxis; negative regulation of axon extension involved in axon guidance; nervous system development; neural crest cell migration; positive regulation of cell migration
Research Articles on SEMA4F
Similar Products
Product Notes
The SEMA4F sema4f (Catalog #AAA1274290) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggcct ctgctgcgcg gccccgcccg ggtcccgggc agcctacagc ctcgcccttc ccgctactgc tgctggcggt gctgagcggc ccggtatccg gccgcgtccc ccgctcggtg cccagaacct cgcttccaat ctctgaggct gactcctgtc tcacccggtt cgcagtccct cacacataca attactctgt tctccttgtg gatcctgcct cccacacact ttatgttggc gcccgggaca ccatcttcgc tttatccctg cccttctcag gggagagacc ccgcaggatt gactggatgg ttcctgaggc tcacagacag aactgtagga agaaaggcaa gaaagagggg gacctcgggg gccggaagac cctccagcag agatggacga cgtttttgaa agctgacctg ctctgtccag ggcctgagca tggccgggcc tccagtgtcc tgcaggatgt tgctgtgctt cgacctgagc ttggggcagg gactcccatc ttttatggca tcttttcttc ccagtgggag ggggctacta tctctgctgt ctgtgccttc cgaccacaag acattcggac agtgctgaat ggtcccttca gagaactaaa acatgactgc aacagaggac tgcctgtcgt ggacaatgat gtgccccagc ccagacctgg agagtgcatc accaacaaca tgaagctccg gcactttggc tcatctctct ccctgcctga ccgcgtactc accttcatcc gggaccaccc actcatggac aggccagtgt ttccagctga tggccacccc ctgctggtca ctacagatac agcctatctc agagtcgtgg cccacagggt gaccagcctc tcagggaaag agtatgatgt gctctacctg gggacagagg atggacacct ccaccgagca gtgcggatcg gagctcagct cagcgttctt gaagatctgg ccttattccc agagccacag ccagttgaga acatgaaatt gtaccacagc tggctcctgg ttggctcccg tactgaggtg acacaagtga atacaaccaa ctgtggccgt ctccagagct gctcagagtg catcctggcc caggacccag tctgtgcctg gagcttccgg ctggatgagt gtgtggccca tgccggggag caccgagggt tggtccaaga catagagtca gcagatgtct cctctttgtg tcctaaagag cctggagaac gtccagtagt gtttgaagtt cccgtggcta cagctgcgca tgtggtcttg ccatgttctc caagctcagc atgggcatcc tgtgtgtggc accagcccag tggagtgact gcactcaccc cccggcggga tggactggag gtggtggtga ccccaggggc catgggcgct tatgcctgtg aatgtcagga gggtggggca gcccatgtgg tagcagctta cagcttggta tggggcagcc agcgagatgc tccgagccgg gcccacacag tgggggcggg actggctggc ttcttcttgg ggattctcgc agcatccctg actctcattc tgattggtcg gcgtcagcag cgacggcgac agagggaact tctggctaga gacaaggtgg gcctggacct gggggctcca ccttctggga ccacaagcta cagccaagac cctccctccc cctctcctga agatgagcgg ttgccgctgg ccctggccaa gaggggcagt ggctttggtg gattctcacc acccttcctg cttgatcctt gcccaagccc agcccacatt cggctaactg gggctcctct agccacatgt gatgaaacat ccatctag. It is sometimes possible for the material contained within the vial of "SEMA4F, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
