Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SEC31A cdna clone

SEC31A cDNA Clone

Gene Names
SEC31A; ABP125; ABP130; HSPC275; HSPC334; SEC31L1
Synonyms
SEC31A; SEC31A cDNA Clone; SEC31A cdna clone
Ordering
For Research Use Only!
Sequence
atgaagttaaaggaagtagatcgtacagccatgcaggcatggagccctgcccagaatcaccccatttacctagcaacaggaacatctgctcagcaattggatgcaacatttagtacgaatgcttcccttgagatatttgaattagacctctctgatccatccttggatatgaaatcttgtgccacattctcctcttctcacaggtaccacaagttgatttgggggccttataaaatggattccaaaggagatgtctctggagttctgattgcaggtggtgaaaatggaaatattattctctatgatccttctaaaattatagctggagacaaggaagttgtgattgcccagaatgacaagcatactggcccagtgagagccttggatgtgaacattttccagactaatctggtagcttctggtgctaatgaatctgaaatctacatatgggatctaaataattttgcaaccccaatgacaccaggagccaaaacacagccgccagaagatatcagctgcattgcatggaacagacaagttcagcatattttagcatcagccagtcccagtggccgggccactgtatgggatcttagaaaaaatgagccaatcatcaaagtcagtgaccatagtaacagaatgcattgttctgggttggcatggcatcctgatgttgctactcagatggtccttgcctccgaggatgaccggttaccagtgatccagatgtgggatcttcgatttgcttcctctccacttcgtgtcctggaaaaccatgccagggggattttggcaattgcttggagcatggcagatcctgaattgttactgagctgtggaaaagatgctaagattctctgctccaatccaaacacaggagaggtgttatatgaacttcccaccaacacacagtggtgcttcgatattcagtggtgtccccgaaatcctgctgtcttatcagctgcttcgtttgatgggcgtatcagtgtttattctatcatgggaggaagcacagatggtttaagacagaaacaagttgacaagctttcatcatcttttgggaatcttgatccctttggcacaggacagccccttcctccgttacaaattccacagcagactgctcagcatagtatagtgctgcctctgaagaagccgcccaagtggattcgaaggcctgttggtgcttctttttcatttggaggcaaactggttacgtttgagaatgtcagaatgccttctcatcagggagctgagcagcagcagcagcagcaccatgtgttcattagtcaggttgtaacagaaaaggagttcctcagccgatcagaccaacttcagcaggctgtgcagtcacaaggatttatcaattattgccaaaaaaaaattgatgcttctcagactgaatttgagaaaaatgtgtggtcctttttgaaggtaaactttgaggatgattctcgtggaaaataccttgaacttctaggatacagaaaagaagatctaggaaagaaggtaaacttttgggaaagttag
Sequence Length
1530
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
127,556 Da
NCBI Official Full Name
Homo sapiens SEC31 homolog A (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
SEC31 homolog A, COPII coat complex component
NCBI Official Symbol
SEC31A
NCBI Official Synonym Symbols
ABP125; ABP130; HSPC275; HSPC334; SEC31L1
NCBI Protein Information
protein transport protein Sec31A
UniProt Protein Name
Protein transport protein Sec31A
Protein Family
UniProt Gene Name
SEC31A
UniProt Synonym Gene Names
KIAA0905; SEC31L1
UniProt Entry Name
SC31A_HUMAN

NCBI Description

The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Uniprot Description

SEC31A: Component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). The coat has two main functions, the physical deformation of the endoplasmic reticulum membrane into vesicles and the selection of cargo molecules. COPII is composed of at least 5 proteins: the SEC23/24 complex, the SEC13/31 complex and SAR1. Interacts with PDCD6 in a calcium-dependent manner. Interacts with KLHL12. Abundantly and ubiquitously expressed. Belongs to the WD repeat SEC31 family. 8 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle; Oncoprotein

Chromosomal Location of Human Ortholog: 4q21.22

Cellular Component: cytoplasm; cytosol; endoplasmic reticulum; endoplasmic reticulum membrane; ER to Golgi transport vesicle; intracellular membrane-bound organelle; perinuclear region of cytoplasm

Molecular Function: calcium-dependent protein binding; protein binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; antigen processing and presentation of peptide antigen via MHC class I; COPII coating of Golgi vesicle; response to calcium ion

Research Articles on SEC31A

Similar Products

Product Notes

The SEC31A sec31a (Catalog #AAA1266231) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagttaa aggaagtaga tcgtacagcc atgcaggcat ggagccctgc ccagaatcac cccatttacc tagcaacagg aacatctgct cagcaattgg atgcaacatt tagtacgaat gcttcccttg agatatttga attagacctc tctgatccat ccttggatat gaaatcttgt gccacattct cctcttctca caggtaccac aagttgattt gggggcctta taaaatggat tccaaaggag atgtctctgg agttctgatt gcaggtggtg aaaatggaaa tattattctc tatgatcctt ctaaaattat agctggagac aaggaagttg tgattgccca gaatgacaag catactggcc cagtgagagc cttggatgtg aacattttcc agactaatct ggtagcttct ggtgctaatg aatctgaaat ctacatatgg gatctaaata attttgcaac cccaatgaca ccaggagcca aaacacagcc gccagaagat atcagctgca ttgcatggaa cagacaagtt cagcatattt tagcatcagc cagtcccagt ggccgggcca ctgtatggga tcttagaaaa aatgagccaa tcatcaaagt cagtgaccat agtaacagaa tgcattgttc tgggttggca tggcatcctg atgttgctac tcagatggtc cttgcctccg aggatgaccg gttaccagtg atccagatgt gggatcttcg atttgcttcc tctccacttc gtgtcctgga aaaccatgcc agggggattt tggcaattgc ttggagcatg gcagatcctg aattgttact gagctgtgga aaagatgcta agattctctg ctccaatcca aacacaggag aggtgttata tgaacttccc accaacacac agtggtgctt cgatattcag tggtgtcccc gaaatcctgc tgtcttatca gctgcttcgt ttgatgggcg tatcagtgtt tattctatca tgggaggaag cacagatggt ttaagacaga aacaagttga caagctttca tcatcttttg ggaatcttga tccctttggc acaggacagc cccttcctcc gttacaaatt ccacagcaga ctgctcagca tagtatagtg ctgcctctga agaagccgcc caagtggatt cgaaggcctg ttggtgcttc tttttcattt ggaggcaaac tggttacgtt tgagaatgtc agaatgcctt ctcatcaggg agctgagcag cagcagcagc agcaccatgt gttcattagt caggttgtaa cagaaaagga gttcctcagc cgatcagacc aacttcagca ggctgtgcag tcacaaggat ttatcaatta ttgccaaaaa aaaattgatg cttctcagac tgaatttgag aaaaatgtgt ggtccttttt gaaggtaaac tttgaggatg attctcgtgg aaaatacctt gaacttctag gatacagaaa agaagatcta ggaaagaagg taaacttttg ggaaagttag. It is sometimes possible for the material contained within the vial of "SEC31A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.