Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SDHA cdna clone

SDHA cDNA Clone

Gene Names
SDHA; FP; PGL5; SDH1; SDH2; SDHF; CMD1GG
Synonyms
SDHA; SDHA cDNA Clone; SDHA cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgggggtccggggcctgtcgcggctgctgagcgctcggcgcctggcgctggccaaggcgtggccaacagtgttgcaaacaggaacccgaggttttcacttcactgttgatgggaacaagagggcatctgctaaagtttcagattccatttctgctcagtatccagtagtggatcatgaatttgatgcagtggtggtaggcgctggaggggcaggcttgcgagctgcatttggcctttctgaggcagggtttaatacagcatgtgttaccaagctgtttcctaccaggtcacacactgttgcagcacagggaggaatcaatgctgctctggggaacatggaggaggacaactggaggtggcatttctacgacaccgtgaagggctccgactggctgggggaccaggatgccatccactacatgacggagcaggcccccgccgccgtggtcgagctagaaaattatggcatgccgtttagcagaactgaagatgggaagatttatcagcgtgcatttggtggacagagcctcaagtttggaaagggcgggcaggcccatcggtgctgctgtgtggctgatcggactggccactcgctattgcacaccttatatggaaggtctctgcgatatgataccagctattttgtggagtattttgccttggatctcctgatggagaatggggagtgccgtggtgtcatcgcactgtgcatagaggacgggtccatccatcgcataagagcaaagaacactgttgttgccacaggaggctacgggcgcacctacttcagctgcacgtctgcccacaccagcactggcgacggcacggccatgatcaccagggcaggccttccttgccaggacctagagtttgttcagttccaccccacaggcatatatggtgctggttgtctcattacggaaggatgtcgtggagagggaggcattctcattaacagtcaaggcgaaaggtttatggagcgatacgcccctgtcgcgaaggacctggcgtctagagatgtggtgtctcggtccatgactctggagatccgagaaggaagaggctgtggccctgagaaagatcacgtctacctgcagctgcaccacctacctccagagcagctggccacgcgcctgcctggcatttcagagacagccatgatcttcgctggcgtggacgtcacgaaggagccgatccctgtcctccccaccgtgcattataacatgggcggcattcccaccaactacaaggggcaggtcctgaggcacgtgaatggccaggatcagattgtgcccggcctgtacgcctgtggggaggccgcctgtgcctcggtacatggtgccaaccgcctcggggcaaactcgctcttggacctggttgtctttggtcgggcatgtgccctgagcatcgaagagtcatgcaggcctggagataaagtccctccaattaaaccaaacgctggggaagaatctgtcatgaatcttgacaaattgagatttgctgatggaagcataagaacatcggaactgcgactcagcatgcagaagtcaatgcaaaatcatgctgccgtgttccgtgtgggaagcgtgttgcaagaaggttgtgggaaaatcagcaagctctatggagacctaaagcacctgaagacgttcgaccggggaatggtctggaacacggacctggtggagaccctggagctgcagaacctgatgctgtgtgcgctgcagaccatctacggagcagaggcacggaaggagtcacggggcgcgcatgccagggaagactacaaggtgcggattgatgagtacgattactccaagcccatccaggggcaacagaagaagccctttgaggagcactggaggaagcacaccctgtcctatgtggacgttggcactgggaaggtcactctggaatatagacccgtgatcgacaaaactttgaacgaggctgactgtgccaccgtcccgccagccattcgctcctactga
Sequence Length
1995
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,650 Da
NCBI Official Full Name
Homo sapiens succinate dehydrogenase complex, subunit A, flavoprotein (Fp), mRNA
NCBI Official Synonym Full Names
succinate dehydrogenase complex flavoprotein subunit A
NCBI Official Symbol
SDHA
NCBI Official Synonym Symbols
FP; PGL5; SDH1; SDH2; SDHF; CMD1GG
NCBI Protein Information
succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial
UniProt Protein Name
Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial
Protein Family
UniProt Gene Name
SDHA
UniProt Synonym Gene Names
SDH2; SDHF; Fp
UniProt Entry Name
SDHA_HUMAN

NCBI Description

This gene encodes a major catalytic subunit of succinate-ubiquinone oxidoreductase, a complex of the mitochondrial respiratory chain. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. Mutations in this gene have been associated with a form of mitochondrial respiratory chain deficiency known as Leigh Syndrome. A pseudogene has been identified on chromosome 3q29. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]

Uniprot Description

SDHA: is the catalytic subunit of succinate dehydrogenase (SDH) complex II of the mitochondrial electron transport chain. Complex II contains four subunits: the flavoprotein catalytic subunit SDHA, iron-sulfur protein SDHB, and a cytochrome b560 composed of SDHC and SDHD. Interaction with SDH5 is required for FAD attachment. Responsible for transferring electrons from succinate to ubiquinone (coenzyme Q). Defects in SDHA cause defective mitochondrial oxidative phosphorylation, giving rise to heterogeneous clinical symptoms ranging from isolated organ dysfunction to multisystem disorder. Acetylation of SDHA may control entry of the substrate into the active site, thus regulating its enzymatic activity. Acetylated SDHA may be a SIRT3 substrate SIRT3 is a mitochondrial NAD(+)-dependent deacetylase. Increased succinate levels as a consequence of SDH deficiency inhibit hypoxia inducible factor-1alpha (HIF-1alpha) prolyl hydroxylases leading to sustained HIF-1alpha expression in tumours. Defects in SDHA cause of Leigh syndrome, a severe disorder characterized by bilaterally symmetrical necrotic lesions in subcortical brain regions.

Protein type: Oxidoreductase; Tumor suppressor; Carbohydrate Metabolism - citrate (TCA) cycle; EC 1.3.5.1; Energy Metabolism - oxidative phosphorylation; Mitochondrial

Chromosomal Location of Human Ortholog: 5p15

Cellular Component: mitochondrial inner membrane; mitochondrial respiratory chain complex II; mitochondrion

Molecular Function: protein binding; succinate dehydrogenase (ubiquinone) activity; succinate dehydrogenase activity

Biological Process: nervous system development; succinate metabolic process; tricarboxylic acid cycle

Disease: Cardiomyopathy, Dilated, 1gg; Leigh Syndrome; Mitochondrial Complex Ii Deficiency; Paragangliomas 5

Research Articles on SDHA

Similar Products

Product Notes

The SDHA sdha (Catalog #AAA1275983) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggggg tccggggcct gtcgcggctg ctgagcgctc ggcgcctggc gctggccaag gcgtggccaa cagtgttgca aacaggaacc cgaggttttc acttcactgt tgatgggaac aagagggcat ctgctaaagt ttcagattcc atttctgctc agtatccagt agtggatcat gaatttgatg cagtggtggt aggcgctgga ggggcaggct tgcgagctgc atttggcctt tctgaggcag ggtttaatac agcatgtgtt accaagctgt ttcctaccag gtcacacact gttgcagcac agggaggaat caatgctgct ctggggaaca tggaggagga caactggagg tggcatttct acgacaccgt gaagggctcc gactggctgg gggaccagga tgccatccac tacatgacgg agcaggcccc cgccgccgtg gtcgagctag aaaattatgg catgccgttt agcagaactg aagatgggaa gatttatcag cgtgcatttg gtggacagag cctcaagttt ggaaagggcg ggcaggccca tcggtgctgc tgtgtggctg atcggactgg ccactcgcta ttgcacacct tatatggaag gtctctgcga tatgatacca gctattttgt ggagtatttt gccttggatc tcctgatgga gaatggggag tgccgtggtg tcatcgcact gtgcatagag gacgggtcca tccatcgcat aagagcaaag aacactgttg ttgccacagg aggctacggg cgcacctact tcagctgcac gtctgcccac accagcactg gcgacggcac ggccatgatc accagggcag gccttccttg ccaggaccta gagtttgttc agttccaccc cacaggcata tatggtgctg gttgtctcat tacggaagga tgtcgtggag agggaggcat tctcattaac agtcaaggcg aaaggtttat ggagcgatac gcccctgtcg cgaaggacct ggcgtctaga gatgtggtgt ctcggtccat gactctggag atccgagaag gaagaggctg tggccctgag aaagatcacg tctacctgca gctgcaccac ctacctccag agcagctggc cacgcgcctg cctggcattt cagagacagc catgatcttc gctggcgtgg acgtcacgaa ggagccgatc cctgtcctcc ccaccgtgca ttataacatg ggcggcattc ccaccaacta caaggggcag gtcctgaggc acgtgaatgg ccaggatcag attgtgcccg gcctgtacgc ctgtggggag gccgcctgtg cctcggtaca tggtgccaac cgcctcgggg caaactcgct cttggacctg gttgtctttg gtcgggcatg tgccctgagc atcgaagagt catgcaggcc tggagataaa gtccctccaa ttaaaccaaa cgctggggaa gaatctgtca tgaatcttga caaattgaga tttgctgatg gaagcataag aacatcggaa ctgcgactca gcatgcagaa gtcaatgcaa aatcatgctg ccgtgttccg tgtgggaagc gtgttgcaag aaggttgtgg gaaaatcagc aagctctatg gagacctaaa gcacctgaag acgttcgacc ggggaatggt ctggaacacg gacctggtgg agaccctgga gctgcagaac ctgatgctgt gtgcgctgca gaccatctac ggagcagagg cacggaagga gtcacggggc gcgcatgcca gggaagacta caaggtgcgg attgatgagt acgattactc caagcccatc caggggcaac agaagaagcc ctttgaggag cactggagga agcacaccct gtcctatgtg gacgttggca ctgggaaggt cactctggaa tatagacccg tgatcgacaa aactttgaac gaggctgact gtgccaccgt cccgccagcc attcgctcct actga. It is sometimes possible for the material contained within the vial of "SDHA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.