Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SDCBP2 cdna clone

SDCBP2 cDNA Clone

Gene Names
SDCBP2; ST-2; SITAC; SITAC18
Synonyms
SDCBP2; SDCBP2 cDNA Clone; SDCBP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcatccctgtacccatctctagaggacctaaaagtggaccaagccattcaggcccaggtcagagcctcacccaagatgccagccctgccagtccaggcaacagccatttccccaccaccagttttgtacccaaacttggcagaactggaaaattatatgggtctttccctctccagccaagaagtccaggagagcctgcttcagattccagagggtgacagtacagcggtctcgggccccgggcccggccagatggtggcaccggtaaccgggtacagcctgggcgtgcggcgagctgagatcaagcccggggtgcgcgagatccacctgtgcaaggacgagcgcggcaagaccgggctgaggctgcggaaggtcgaccaggggctctttgtgcagttggtccaggccaacacccctgcatcccttgtggggctgcgctttggggaccagctcctgcagattgacgggcgtgactgtgctgggtggagctcgcacaaagcccatcaggtggtgaagaaggcatcaggcgataagattgtcgtggtggttcgggacaggccgttccagcggactgtcaccatgcacaaggacagcatgggccacgtcggcttcgtgatcaagaaggggaagattgtctctctggtcaaagggagttctgcggcccgcaacgggctcctcaccaaccactacgtgtgtgaggtagacgggcagaatgttatcgggctgaaggacaaaaagatcatggagattctggccacggctgggaacgttgtcaccctgaccatcatccccagtgtgatctacgagcacatggtcaaaaagttgcctccagtcctgctccaccacaccatggaccactccatcccagatgcctga
Sequence Length
879
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,664 Da
NCBI Official Full Name
Homo sapiens syndecan binding protein (syntenin) 2, mRNA
NCBI Official Synonym Full Names
syndecan binding protein 2
NCBI Official Symbol
SDCBP2
NCBI Official Synonym Symbols
ST-2; SITAC; SITAC18
NCBI Protein Information
syntenin-2
UniProt Protein Name
Syntenin-2
Protein Family
UniProt Gene Name
SDCBP2
UniProt Synonym Gene Names
SITAC18
UniProt Entry Name
SDCB2_HUMAN

NCBI Description

The protein encoded by this gene contains two class II PDZ domains. PDZ domains facilitate protein-protein interactions by binding to the cytoplasmic C-terminus of transmembrane proteins, and PDZ-containing proteins mediate cell signaling and the organization of protein complexes. The encoded protein binds to phosphatidylinositol 4, 5-bisphosphate (PIP2) and plays a role in nuclear PIP2 organization and cell division. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Read-through transcription also exists between this gene and the upstream FKBP1A (FK506 binding protein 1A, 12kDa) gene, as represented in GeneID:100528031. [provided by RefSeq, Sep 2011]

Uniprot Description

SDCBP2: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 20p13

Cellular Component: cytoplasm; plasma membrane

Molecular Function: identical protein binding; protein binding; protein C-terminus binding; protein heterodimerization activity; protein homodimerization activity

Research Articles on SDCBP2

Similar Products

Product Notes

The SDCBP2 sdcbp2 (Catalog #AAA1267752) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcatccc tgtacccatc tctagaggac ctaaaagtgg accaagccat tcaggcccag gtcagagcct cacccaagat gccagccctg ccagtccagg caacagccat ttccccacca ccagttttgt acccaaactt ggcagaactg gaaaattata tgggtctttc cctctccagc caagaagtcc aggagagcct gcttcagatt ccagagggtg acagtacagc ggtctcgggc cccgggcccg gccagatggt ggcaccggta accgggtaca gcctgggcgt gcggcgagct gagatcaagc ccggggtgcg cgagatccac ctgtgcaagg acgagcgcgg caagaccggg ctgaggctgc ggaaggtcga ccaggggctc tttgtgcagt tggtccaggc caacacccct gcatcccttg tggggctgcg ctttggggac cagctcctgc agattgacgg gcgtgactgt gctgggtgga gctcgcacaa agcccatcag gtggtgaaga aggcatcagg cgataagatt gtcgtggtgg ttcgggacag gccgttccag cggactgtca ccatgcacaa ggacagcatg ggccacgtcg gcttcgtgat caagaagggg aagattgtct ctctggtcaa agggagttct gcggcccgca acgggctcct caccaaccac tacgtgtgtg aggtagacgg gcagaatgtt atcgggctga aggacaaaaa gatcatggag attctggcca cggctgggaa cgttgtcacc ctgaccatca tccccagtgt gatctacgag cacatggtca aaaagttgcc tccagtcctg ctccaccaca ccatggacca ctccatccca gatgcctga. It is sometimes possible for the material contained within the vial of "SDCBP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.