SCPEP1 cdna clone
SCPEP1 cDNA Clone
Gene Names
SCPEP1; RISC; HSCP1
Synonyms
SCPEP1; SCPEP1 cDNA Clone; SCPEP1 cdna clone
Sequence
atggagctggcactgcggcgctctcccgtcccgcggtggttgctgctgctgccgctgctgctgggcctgaacgcaggagctgtcattgactggcccacagaggagggcaaggaagtatgggattatgtgacggtccgcaaggatgcctacatgttctggtggctctattatgccaccaactcctgcaagaacttctcagaactgcccctggtcatgtggcttcagggcggtccaggcggttctagcactggatttggaaactttgaggaaattgggccccttgacagtgatctcaaaccacggaaaaccacctggctccaggctgccagtctcctatttgtggataatcccgtgggcactgggttcagttatgtgaatggtagtggtgcctatgccaaggacctggctatggtggcttcagacatgatggttctcctgaagaccttcttcagttgccacaaagaattccagacagttccattctacattttctcagagtcctatggaggaaaaatggcagctggcattggtctagagctttataaggccattcagcgagggaccatcaagtgcaactttgcgggggttgccttgggtgattcctggatctcccctgttgattcggtgctctcctggggaccttacctgtacagcatgtctcttctcgaagacaaaggtctggcagaggtgtctaaggttgcagagcaagtactgaatgccgtaaataaggggctctacagagaggccacagagctgtgggggaaagcagaaatgatcattgaacagaacacagatggggtgaacttctataacatcttaactaaaagcactcccacgtctacaatggagtcgagtctagaattcacacagagccacctagtttggttttag
Sequence Length
891
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
32,957 Da
NCBI Official Full Name
Homo sapiens serine carboxypeptidase 1, mRNA
NCBI Official Synonym Full Names
serine carboxypeptidase 1
NCBI Official Symbol
SCPEP1
NCBI Official Synonym Symbols
RISC; HSCP1
NCBI Protein Information
retinoid-inducible serine carboxypeptidase
UniProt Protein Name
Retinoid-inducible serine carboxypeptidase
Protein Family
UniProt Gene Name
SCPEP1
UniProt Synonym Gene Names
RISC; SCP1
UniProt Entry Name
RISC_HUMAN
Uniprot Description
SCPEP1: May be involved in vascular wall and kidney homeostasis. Belongs to the peptidase S10 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Secreted, signal peptide; Secreted; Protease; EC 3.4.16.-
Chromosomal Location of Human Ortholog: 17q22
Cellular Component: cytosol
Molecular Function: serine carboxypeptidase activity
Biological Process: negative regulation of blood pressure; positive regulation of vasodilation; proteolysis involved in cellular protein catabolic process; retinoic acid metabolic process
Research Articles on SCPEP1
Similar Products
Product Notes
The SCPEP1 scpep1 (Catalog #AAA1267103) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctgg cactgcggcg ctctcccgtc ccgcggtggt tgctgctgct gccgctgctg ctgggcctga acgcaggagc tgtcattgac tggcccacag aggagggcaa ggaagtatgg gattatgtga cggtccgcaa ggatgcctac atgttctggt ggctctatta tgccaccaac tcctgcaaga acttctcaga actgcccctg gtcatgtggc ttcagggcgg tccaggcggt tctagcactg gatttggaaa ctttgaggaa attgggcccc ttgacagtga tctcaaacca cggaaaacca cctggctcca ggctgccagt ctcctatttg tggataatcc cgtgggcact gggttcagtt atgtgaatgg tagtggtgcc tatgccaagg acctggctat ggtggcttca gacatgatgg ttctcctgaa gaccttcttc agttgccaca aagaattcca gacagttcca ttctacattt tctcagagtc ctatggagga aaaatggcag ctggcattgg tctagagctt tataaggcca ttcagcgagg gaccatcaag tgcaactttg cgggggttgc cttgggtgat tcctggatct cccctgttga ttcggtgctc tcctggggac cttacctgta cagcatgtct cttctcgaag acaaaggtct ggcagaggtg tctaaggttg cagagcaagt actgaatgcc gtaaataagg ggctctacag agaggccaca gagctgtggg ggaaagcaga aatgatcatt gaacagaaca cagatggggt gaacttctat aacatcttaa ctaaaagcac tcccacgtct acaatggagt cgagtctaga attcacacag agccacctag tttggtttta g. It is sometimes possible for the material contained within the vial of "SCPEP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
