Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SCARA3 cdna clone

SCARA3 cDNA Clone

Gene Names
SCARA3; CSR; APC7; CSR1; MSLR1; MSRL1
Synonyms
SCARA3; SCARA3 cDNA Clone; SCARA3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaagtgaggtcggccggcggcgatggagatgccttgtgcgttacagaagaggacctggcgggtgacgacgaggacatgccgaccttcccatgcacccagaagggccggccagggccccgctgcagccgctgccagaagaacctatctttgcacacatcggtgcggattctttacctcttcctggccctgctcctggtggccgtggctgtgttggcctctctggttttcagaaaagtggactctctctccgaagacatctccttgacccagtctatttatgacaagaagcttgtgttaatgcagaaaaatctccagggcctggatccgaaagccctgaacaactgctctttctgccatgaagctgggcagctggggccagagatccgaaaactgcaggaggagctggagggaattcagaagctgcttctggcccaggaggtgcagctggaccagaccttacaggcccaggaggtgctctccaccaccagcagacaaatctcccaggagatgggcagttgctccttctccatccaccaggttaaccagtctctggggctcttcctggcccaggtgagaggctggcaggccaccacagctggcctggacctctctctgaaggacctcacccaggagtgctacgatgtcaaggctgcagtgcaccagatcaacttcaccgtggggcagacttccgagtggatccacgggatccagcggaagacagacgaggagaccctgaccctccagaagattgtcaccgactggcagaactacacacggctcttcagcggcctgcgcaccacctccaccaagactggagaggcggtcaagaacatccaggccaccctgggggcctcctcacagcgcatcagccagaactcagagagcatgcacgacctggtactccaggtcatgggcttgcagctgcagctggataacatctcgtccttcctggatgaccacgaagagaacatgcatgatcttcagtaccatacccactacgcccagaaccgcactgtggagaggtttgagtctctggaaggacgcatggcttctcacgagattgaaattggcaccatcttcaccaacatcaatgccaccgacaaccacgtgcacagcatgctcaagtacctggatgacgtgcggctctcctgcacgctgggcttccacacccatgccgaggagctctactacctgaacaagtctgtctccatcatgctgggcaccacagacctgctccgggagcgcttcagcctgctcagtgcccggctggacctcaacgtccggaacctctccatgatcgtggaggagatgaaggcagtggacacacagcatggagaaatccttcgcaatgtcaccatcctacgaggtcacactttgttttcacataatcggatatga
Sequence Length
1401
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,434 Da
NCBI Official Full Name
Homo sapiens scavenger receptor class A, member 3, mRNA
NCBI Official Synonym Full Names
scavenger receptor class A member 3
NCBI Official Symbol
SCARA3
NCBI Official Synonym Symbols
CSR; APC7; CSR1; MSLR1; MSRL1
NCBI Protein Information
scavenger receptor class A member 3
UniProt Protein Name
Scavenger receptor class A member 3
Protein Family
UniProt Gene Name
SCARA3
UniProt Synonym Gene Names
CSR
UniProt Entry Name
SCAR3_HUMAN

NCBI Description

This gene encodes a macrophage scavenger receptor-like protein. This protein has been shown to deplete reactive oxygen species, and thus play an important role in protecting cells from oxidative stress. The expression of this gene is induced by oxidative stress. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

CSR: a ubiquitous single-pass type II membrane protein of the endoplasmic reticulum and/or Golgi that may function as a tumor suppressor. Protects against intracellular damage by scavenging oxidative molecules produced by oxidative stress and UV irradiation. Frequently down-regulated and methylated in prostate cancer samples. Two alternatively spliced human isoforms have been described, CSR1 and -2.

Protein type: Receptor, misc.; Membrane protein, integral

Chromosomal Location of Human Ortholog: 8p21

Molecular Function: protein binding; scavenger receptor activity; structural molecule activity

Biological Process: response to oxidative stress; toll-like receptor 3 signaling pathway; UV protection

Research Articles on SCARA3

Similar Products

Product Notes

The SCARA3 scara3 (Catalog #AAA1268122) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagtga ggtcggccgg cggcgatgga gatgccttgt gcgttacaga agaggacctg gcgggtgacg acgaggacat gccgaccttc ccatgcaccc agaagggccg gccagggccc cgctgcagcc gctgccagaa gaacctatct ttgcacacat cggtgcggat tctttacctc ttcctggccc tgctcctggt ggccgtggct gtgttggcct ctctggtttt cagaaaagtg gactctctct ccgaagacat ctccttgacc cagtctattt atgacaagaa gcttgtgtta atgcagaaaa atctccaggg cctggatccg aaagccctga acaactgctc tttctgccat gaagctgggc agctggggcc agagatccga aaactgcagg aggagctgga gggaattcag aagctgcttc tggcccagga ggtgcagctg gaccagacct tacaggccca ggaggtgctc tccaccacca gcagacaaat ctcccaggag atgggcagtt gctccttctc catccaccag gttaaccagt ctctggggct cttcctggcc caggtgagag gctggcaggc caccacagct ggcctggacc tctctctgaa ggacctcacc caggagtgct acgatgtcaa ggctgcagtg caccagatca acttcaccgt ggggcagact tccgagtgga tccacgggat ccagcggaag acagacgagg agaccctgac cctccagaag attgtcaccg actggcagaa ctacacacgg ctcttcagcg gcctgcgcac cacctccacc aagactggag aggcggtcaa gaacatccag gccaccctgg gggcctcctc acagcgcatc agccagaact cagagagcat gcacgacctg gtactccagg tcatgggctt gcagctgcag ctggataaca tctcgtcctt cctggatgac cacgaagaga acatgcatga tcttcagtac catacccact acgcccagaa ccgcactgtg gagaggtttg agtctctgga aggacgcatg gcttctcacg agattgaaat tggcaccatc ttcaccaaca tcaatgccac cgacaaccac gtgcacagca tgctcaagta cctggatgac gtgcggctct cctgcacgct gggcttccac acccatgccg aggagctcta ctacctgaac aagtctgtct ccatcatgct gggcaccaca gacctgctcc gggagcgctt cagcctgctc agtgcccggc tggacctcaa cgtccggaac ctctccatga tcgtggagga gatgaaggca gtggacacac agcatggaga aatccttcgc aatgtcacca tcctacgagg tcacactttg ttttcacata atcggatatg a. It is sometimes possible for the material contained within the vial of "SCARA3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.