SCAPER cdna clone
SCAPER cDNA Clone
Gene Names
SCAPER; ZNF291; Zfp291; MSTP063
Synonyms
SCAPER; SCAPER cDNA Clone; SCAPER cdna clone
Sequence
atgggtctgattgacaaactgtgtgcctgcttcctctcggtgcaaggcccagtggatgagaatcccaagatggccatatttctgcagcatgccgcaggactcttacatgcaatgtgtacactgtgctttgctgtcactggaaggtcatacagcatatttgacaataatcgccaggatcccacagggctgacagctgctcttcaggcaaccgacctggctggagttcttcatatgctctactgtgtcctcttccatggcaccatcttggaccccagcactgccagtcccaaggagaattacactcaaaataccatccaagtggccattcagagtttacgtttcttcaacagctttgcagctcttcatctgcctgcttttcagtctattgtaggggcagagggcttgtcccttgcattccggcacatggccagctccctgctgggccactgcagccaagtctcctgtgaaagcctccttcatgaggtcatcgtctgtgtgggctacttcactgtcaaccacccagataaccaggtgatcgtgcagtccggccgccaccccacagtgctgcagaagctctgccagttgcccttccagtatttcagtgacccacggctgatcaaagtactgttcccttcacttatcgctgcttgttacaacaaccatcagaacaagatcattctggagcaagagatgagctgtgttttactggccactttcattcaggatttggcacagactccaggtcaagcggaaaaccagccttaccaacccaaagggaaatgccttggttcccaagactatcttgagctggctaacagatttcctcagcaggcctgggaagaagctcgacagtttttcttgaaaaaagagaaaaaataa
Sequence Length
879
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
130,935 Da
NCBI Official Full Name
Homo sapiens S-phase cyclin A-associated protein in the ER, mRNA
NCBI Official Synonym Full Names
S-phase cyclin A associated protein in the ER
NCBI Official Symbol
SCAPER
NCBI Official Synonym Symbols
ZNF291; Zfp291; MSTP063
NCBI Protein Information
S phase cyclin A-associated protein in the endoplasmic reticulum
UniProt Protein Name
S phase cyclin A-associated protein in the endoplasmic reticulum
Protein Family
UniProt Gene Name
SCAPER
UniProt Synonym Gene Names
KIAA1454; ZNF291; S phase cyclin A-associated protein in the ER
UniProt Entry Name
SCAPE_HUMAN
Uniprot Description
ZNF291: CCNA2/CDK2 regulatory protein that transiently maintains CCNA2 in the cytoplasm. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 15q24
Cellular Component: cytoplasm; nucleus
Research Articles on SCAPER
Similar Products
Product Notes
The SCAPER scaper (Catalog #AAA1266590) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtctga ttgacaaact gtgtgcctgc ttcctctcgg tgcaaggccc agtggatgag aatcccaaga tggccatatt tctgcagcat gccgcaggac tcttacatgc aatgtgtaca ctgtgctttg ctgtcactgg aaggtcatac agcatatttg acaataatcg ccaggatccc acagggctga cagctgctct tcaggcaacc gacctggctg gagttcttca tatgctctac tgtgtcctct tccatggcac catcttggac cccagcactg ccagtcccaa ggagaattac actcaaaata ccatccaagt ggccattcag agtttacgtt tcttcaacag ctttgcagct cttcatctgc ctgcttttca gtctattgta ggggcagagg gcttgtccct tgcattccgg cacatggcca gctccctgct gggccactgc agccaagtct cctgtgaaag cctccttcat gaggtcatcg tctgtgtggg ctacttcact gtcaaccacc cagataacca ggtgatcgtg cagtccggcc gccaccccac agtgctgcag aagctctgcc agttgccctt ccagtatttc agtgacccac ggctgatcaa agtactgttc ccttcactta tcgctgcttg ttacaacaac catcagaaca agatcattct ggagcaagag atgagctgtg ttttactggc cactttcatt caggatttgg cacagactcc aggtcaagcg gaaaaccagc cttaccaacc caaagggaaa tgccttggtt cccaagacta tcttgagctg gctaacagat ttcctcagca ggcctgggaa gaagctcgac agtttttctt gaaaaaagag aaaaaataa. It is sometimes possible for the material contained within the vial of "SCAPER, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
