Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SC5DL cdna clone

SC5DL cDNA Clone

Gene Names
SC5D; ERG3; S5DES; SC5DL
Synonyms
SC5DL; SC5DL cDNA Clone; SC5DL cdna clone
Ordering
For Research Use Only!
Sequence
atggatcttgtactccgtgttgcagattactatttttttacaccatacgtgtatccagccacatggccagaagatgacatcttccgacaagctattagtcttctgattgtaacaaatgttggtgcttacatcctttatttcttctgtgcaacactgagctattattttgtcttcgatcatgcattaatgaaacatccacaatttttaaagaatcaagtccgtcgagagattaagtttactgtccaggcattgccatggataagtattcttactgttgcactgttcttgctggagataagaggttacagcaaattacatgatgacctaggagagtttccatatggattgtttgaacttgtcgttagtataatatctttcctctttttcactgacatgttcatctactggattcacagaggccttcatcatagactggtatataagcgcctacataaacctcaccatatttggaagattcctactccatttgcaagtcatgcttttcaccctattgatggctttcttcagagtctaccttaccatatatacccttttatctttccattacacaaggtggtttatttaagtctgtacatcttggttaatatctggacaatttccattcatgacggtgattttcgtgtcccccaaatcttacagccatttattaatggctcagctcatcatacagaccaccatatgttctttgactataattatggacaatatttcactttgtgggataggattggcggctcattcaaaaatccttcatcctttgaggggaagggaccgctcagttatgtgaaggagatgacagagggaaagcgcagcagccattcaggaaatggctgtaagaatgaaaaattattcaatggagagtttacaaagactgaatag
Sequence Length
900
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,301 Da
NCBI Official Full Name
Homo sapiens sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S. cerevisiae)-like, mRNA
NCBI Official Synonym Full Names
sterol-C5-desaturase
NCBI Official Symbol
SC5D
NCBI Official Synonym Symbols
ERG3; S5DES; SC5DL
NCBI Protein Information
lathosterol oxidase
UniProt Protein Name
Lathosterol oxidase
UniProt Gene Name
SC5D
UniProt Synonym Gene Names
SC5DL
UniProt Entry Name
SC5D_HUMAN

NCBI Description

This gene encodes an enzyme of cholesterol biosynthesis. The encoded protein catalyzes the conversion of lathosterol into 7-dehydrocholesterol. Mutations in this gene have been associated with lathosterolosis. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

SC5DL: Catalyzes a dehydrogenation to introduce C5-6 double bond into lathosterol. Defects in SC5DL are the cause of lathosterolosis (LATHST). This autosomal recessive disorder is characterized by a complex phenotype, including multiple congenital anomalies, mental retardation, and liver disease. Belongs to the sterol desaturase family.

Protein type: Membrane protein, integral; Lipid Metabolism - steroid biosynthesis; Oxidoreductase; Membrane protein, multi-pass; EC 1.14.21.6

Chromosomal Location of Human Ortholog: 11q23.3

Cellular Component: endoplasmic reticulum membrane

Molecular Function: C-5 sterol desaturase activity

Biological Process: cholesterol biosynthetic process via desmosterol; cholesterol biosynthetic process via lathosterol; lipid metabolic process

Disease: Lathosterolosis

Research Articles on SC5DL

Similar Products

Product Notes

The SC5DL sc5d (Catalog #AAA1273135) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatcttg tactccgtgt tgcagattac tattttttta caccatacgt gtatccagcc acatggccag aagatgacat cttccgacaa gctattagtc ttctgattgt aacaaatgtt ggtgcttaca tcctttattt cttctgtgca acactgagct attattttgt cttcgatcat gcattaatga aacatccaca atttttaaag aatcaagtcc gtcgagagat taagtttact gtccaggcat tgccatggat aagtattctt actgttgcac tgttcttgct ggagataaga ggttacagca aattacatga tgacctagga gagtttccat atggattgtt tgaacttgtc gttagtataa tatctttcct ctttttcact gacatgttca tctactggat tcacagaggc cttcatcata gactggtata taagcgccta cataaacctc accatatttg gaagattcct actccatttg caagtcatgc ttttcaccct attgatggct ttcttcagag tctaccttac catatatacc cttttatctt tccattacac aaggtggttt atttaagtct gtacatcttg gttaatatct ggacaatttc cattcatgac ggtgattttc gtgtccccca aatcttacag ccatttatta atggctcagc tcatcataca gaccaccata tgttctttga ctataattat ggacaatatt tcactttgtg ggataggatt ggcggctcat tcaaaaatcc ttcatccttt gaggggaagg gaccgctcag ttatgtgaag gagatgacag agggaaagcg cagcagccat tcaggaaatg gctgtaagaa tgaaaaatta ttcaatggag agtttacaaa gactgaatag. It is sometimes possible for the material contained within the vial of "SC5DL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.