Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SBDS cdna clone

SBDS cDNA Clone

Gene Names
SBDS; SDS; SWDS; CGI-97
Synonyms
SBDS; SBDS cDNA Clone; SBDS cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgatcttcacccccaccaaccagatccgcctaaccaatgtggccgtggtacggatgaagcgtgccgggaagcgcttcgaaatcgcctgctacaaaaacaaggtcgtcggctggcggagcggcgtggaaaaagacctcgatgaagttctgcagacccactcagtgtttgtaaatgtttctaaaggtcaggttgccaaaaaggaagatctcatcagtgcgtttggaacagatgaccaaactgaaatctgtaagcagattttgactaaaggagaagttcaagtatcagataaagaaagacacacacaactggagcagatgtttagggacattgcaactattgtggcagacaaatgtgtgaatcctgaaacaaagagaccatacaccgtgatccttattgagagagccatgaaggacatccactattcggtgaaaaccaacaagagtacaaaacagcaggctttggaagtgataaagcagttaaaagagaaaatgaagatagaacgtgctcacatgaggcttcggttcatccttccagtcaatgaaggcaagaagctgaaagaaaagctcaagccactgatcaaggtcatagaaagtgaagattatggccaacagttagaaatcgtatgtctgattgacccgggctgcttccgagaaattgatgagctaataaaaaaggaaactaaaggcaaaggttctttggaagtactcaatctgaaagatgtagaagaaggagatgagaaatttgaatga
Sequence Length
753
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,764 Da
NCBI Official Full Name
Homo sapiens Shwachman-Bodian-Diamond syndrome, mRNA
NCBI Official Synonym Full Names
SBDS ribosome assembly guanine nucleotide exchange factor
NCBI Official Symbol
SBDS
NCBI Official Synonym Symbols
SDS; SWDS; CGI-97
NCBI Protein Information
ribosome maturation protein SBDS
UniProt Protein Name
Ribosome maturation protein SBDS
UniProt Gene Name
SBDS
UniProt Entry Name
SBDS_HUMAN

NCBI Description

This gene encodes a member of a highly conserved protein family that exists from archaea to vertebrates and plants. The encoded protein may function in RNA metabolism. Mutations within this gene are associated with Shwachman-Bodian-Diamond syndrome. An alternative transcript has been described, but its biological nature has not been determined. This gene has a closely linked pseudogene that is distally located. [provided by RefSeq, Jul 2008]

Uniprot Description

SBDS: Required for the assembly of mature ribosomes and ribosome biogenesis. Together with EFTUD1, triggers the GTP- dependent release of EIF6 from 60S pre-ribosomes in the cytoplasm, thereby activating ribosomes for translation competence by allowing 80S ribosome assembly and facilitating EIF6 recycling to the nucleus, where it is required for 60S rRNA processing and nuclear export. Required for normal levels of protein synthesis. May play a role in cellular stress resistance. May play a role in cellular response to DNA damage. May play a role in cell proliferation. Defects in SBDS are the cause of Shwachman-Diamond syndrome (SDS). SDS is an autosomal recessive disorder characterized by pancreatic exocrine insufficiency, hematologic dysfunction, and skeletal abnormalities. Belongs to the SDO1/SBDS family.

Protein type: Nucleolus

Chromosomal Location of Human Ortholog: 7q11.21

Cellular Component: cytoplasm; nucleolus; nucleus; spindle pole

Molecular Function: microtubule binding; protein binding; ribosome binding; rRNA binding

Biological Process: bone marrow development; bone mineralization; cell proliferation; leukocyte chemotaxis; mature ribosome assembly; mitotic spindle organization and biogenesis; rRNA processing

Disease: Aplastic Anemia; Shwachman-diamond Syndrome

Research Articles on SBDS

Similar Products

Product Notes

The SBDS sbds (Catalog #AAA1272726) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgatct tcacccccac caaccagatc cgcctaacca atgtggccgt ggtacggatg aagcgtgccg ggaagcgctt cgaaatcgcc tgctacaaaa acaaggtcgt cggctggcgg agcggcgtgg aaaaagacct cgatgaagtt ctgcagaccc actcagtgtt tgtaaatgtt tctaaaggtc aggttgccaa aaaggaagat ctcatcagtg cgtttggaac agatgaccaa actgaaatct gtaagcagat tttgactaaa ggagaagttc aagtatcaga taaagaaaga cacacacaac tggagcagat gtttagggac attgcaacta ttgtggcaga caaatgtgtg aatcctgaaa caaagagacc atacaccgtg atccttattg agagagccat gaaggacatc cactattcgg tgaaaaccaa caagagtaca aaacagcagg ctttggaagt gataaagcag ttaaaagaga aaatgaagat agaacgtgct cacatgaggc ttcggttcat ccttccagtc aatgaaggca agaagctgaa agaaaagctc aagccactga tcaaggtcat agaaagtgaa gattatggcc aacagttaga aatcgtatgt ctgattgacc cgggctgctt ccgagaaatt gatgagctaa taaaaaagga aactaaaggc aaaggttctt tggaagtact caatctgaaa gatgtagaag aaggagatga gaaatttgaa tga. It is sometimes possible for the material contained within the vial of "SBDS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.