SAT2 cdna clone
SAT2 cDNA Clone
Gene Names
SAT2; SSAT2
Synonyms
SAT2; SAT2 cDNA Clone; SAT2 cdna clone
Sequence
atggcttccgtgcggatccgagaggccaaggagggagactgtggagatatcctgaggctgattcgggagctagccgaattcgaaaaactctcggatcaggtgaagatcagtgaagaagccctgagagcagatggctttggagacaatcctttctatcactgtttggtagcagagattcttccagcgcccgggaagctactggggccctgcgtggtgggctatgggatatactatttcatctacagtacatggaagggacgcaccatttatctggaggatatctatgtgatgccggaatatcggggtcaagggattggttccaaaataatcaaaaaggtggctgaggtggccttggataagggctgctcccaattccgcctggccgtcctggactggaaccagagggccatggacttgtacaaggccctaggagcccaagatctgacggaagctgagggctggcacttcttctgctttcaaggagaggcaacgagaaagttggcaggaaagtga
Sequence Length
513
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
19,155 Da
NCBI Official Full Name
Homo sapiens spermidine/spermine N1-acetyltransferase family member 2, mRNA
NCBI Official Synonym Full Names
spermidine/spermine N1-acetyltransferase family member 2
NCBI Official Symbol
SAT2
NCBI Official Synonym Symbols
SSAT2
NCBI Protein Information
diamine acetyltransferase 2
UniProt Protein Name
Diamine acetyltransferase 2
Protein Family
UniProt Gene Name
SAT2
UniProt Synonym Gene Names
SSAT2
UniProt Entry Name
SAT2_HUMAN
Uniprot Description
SAT2: Enzyme which catalyzes the acetylation of polyamines. Substrate specificity: norspermidine > spermidine = spermine >> N(1)acetylspermine = putrescine. Belongs to the acetyltransferase family.
Protein type: Amino Acid Metabolism - arginine and proline; Acetyltransferase; EC 2.3.1.57
Chromosomal Location of Human Ortholog: 17p13.1
Molecular Function: diamine N-acetyltransferase activity
Biological Process: nor-spermidine metabolic process; putrescine acetylation; spermidine acetylation; spermine acetylation
Research Articles on SAT2
1. Observational study of gene-disease association and gene-environment interaction. (HuGE Navigator)
Similar Products
Product Notes
The SAT2 sat2 (Catalog #AAA1274761) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttccg tgcggatccg agaggccaag gagggagact gtggagatat cctgaggctg attcgggagc tagccgaatt cgaaaaactc tcggatcagg tgaagatcag tgaagaagcc ctgagagcag atggctttgg agacaatcct ttctatcact gtttggtagc agagattctt ccagcgcccg ggaagctact ggggccctgc gtggtgggct atgggatata ctatttcatc tacagtacat ggaagggacg caccatttat ctggaggata tctatgtgat gccggaatat cggggtcaag ggattggttc caaaataatc aaaaaggtgg ctgaggtggc cttggataag ggctgctccc aattccgcct ggccgtcctg gactggaacc agagggccat ggacttgtac aaggccctag gagcccaaga tctgacggaa gctgagggct ggcacttctt ctgctttcaa ggagaggcaa cgagaaagtt ggcaggaaag tga. It is sometimes possible for the material contained within the vial of "SAT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
