SAR1A cdna clone
SAR1A cDNA Clone
Gene Names
SAR1A; SAR1; Sara; SARA1; masra2
Synonyms
SAR1A; SAR1A cDNA Clone; SAR1A cdna clone
Sequence
atgtctttcatctttgagtggatctacaatggcttcagcagtgtgctccagttcctaggactgtacaagaaatctggaaaacttgtattcttaggtttggataatgcaggcaaaaccactcttcttcacatgctcaaagatgacagattgggccaacatgttccaacactacatccgacatcagaagagctaacaattgctggaatgacctttacaacttttgatcttggtgggcacgagcaagcacgtcgcgtttggaaaaattatctcccagcaattaatgggattgtctttctggtggactgtgcagatcattctcgcctcgtggaatccaaagttgagcttaatgctttaatgactgatgaaacaatatccaatgtgccaatccttatcttgggtaacaaaattgacagaacagatgcaatcagtgaagaaaaactccgtgagatatttgggctttatggacagaccacaggaaaggggaatgtgaccctgaaggagctgaatgctcgccccatggaagtgttcatgtgcagtgtgctcaagaggcaaggttacggcgagggtttccgctggctctcccagtatattgactga
Sequence Length
597
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
17,500 Da
NCBI Official Full Name
Homo sapiens SAR1 homolog A (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
secretion associated Ras related GTPase 1A
NCBI Official Symbol
SAR1A
NCBI Official Synonym Symbols
SAR1; Sara; SARA1; masra2
NCBI Protein Information
GTP-binding protein SAR1a
UniProt Protein Name
GTP-binding protein SAR1a
Protein Family
UniProt Gene Name
SAR1A
UniProt Synonym Gene Names
SAR1; SARA; SARA1
UniProt Entry Name
SAR1A_HUMAN
Uniprot Description
SAR1A: Involved in transport from the endoplasmic reticulum to the Golgi apparatus. Required to maintain SEC16A localization at discrete locations on the ER membrane perhaps by preventing its dissociation. SAR1A-GTP-dependent assembly of SEC16A on the ER membrane forms an organized scaffold defining endoplasmic reticulum exit sites (ERES). Belongs to the small GTPase superfamily. SAR1 family.
Protein type: G protein, monomeric; G protein; G protein, monomeric, SAR1
Chromosomal Location of Human Ortholog: 10q22.1
Molecular Function: protein binding
Research Articles on SAR1A
Similar Products
Product Notes
The SAR1A sar1a (Catalog #AAA1266690) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctttca tctttgagtg gatctacaat ggcttcagca gtgtgctcca gttcctagga ctgtacaaga aatctggaaa acttgtattc ttaggtttgg ataatgcagg caaaaccact cttcttcaca tgctcaaaga tgacagattg ggccaacatg ttccaacact acatccgaca tcagaagagc taacaattgc tggaatgacc tttacaactt ttgatcttgg tgggcacgag caagcacgtc gcgtttggaa aaattatctc ccagcaatta atgggattgt ctttctggtg gactgtgcag atcattctcg cctcgtggaa tccaaagttg agcttaatgc tttaatgact gatgaaacaa tatccaatgt gccaatcctt atcttgggta acaaaattga cagaacagat gcaatcagtg aagaaaaact ccgtgagata tttgggcttt atggacagac cacaggaaag gggaatgtga ccctgaagga gctgaatgct cgccccatgg aagtgttcat gtgcagtgtg ctcaagaggc aaggttacgg cgagggtttc cgctggctct cccagtatat tgactga. It is sometimes possible for the material contained within the vial of "SAR1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
