SAP30L cdna clone
SAP30L cDNA Clone
Gene Names
SAP30L; NS4ATP2
Synonyms
SAP30L; SAP30L cDNA Clone; SAP30L cdna clone
Sequence
atgaacggcttcagcacggaggaggacagccgcgaagggccccccgccgccccagctgccgccgccccgggctacggccagagctgctgcctcatcgaggacggcgagcgctgcgtccggcccgcgggcaacgcctccttcagcaagagggtccagaagagcatctcgcagaagaaactcaagctggacatcgacaagagcgtaaggcacctatatatctgtgattttcacaaaaatttcatccagagtgtccgaaataaaaggaagaggaagacaagtgacgatggcggagattctcccgagcacgacactgacattcctgaggttgatctgttccagctgcaggtgaacaccctacgacgttataaacgacactacaagttgcagaccagaccaggcttcaataaggcccagttagcagaaactgtgagtcgacacttcaggaacatacctgtgaatgaaaaagagacccttgcctacttcatctacatggtgaagagtaacaagagtagactggaccagaaatcggagggtggcaagcagcttgagtga
Sequence Length
552
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
16,039 Da
NCBI Official Full Name
Homo sapiens SAP30-like, mRNA
NCBI Official Synonym Full Names
SAP30 like
NCBI Official Symbol
SAP30L
NCBI Official Synonym Symbols
NS4ATP2
NCBI Protein Information
histone deacetylase complex subunit SAP30L
UniProt Protein Name
Histone deacetylase complex subunit SAP30L
Protein Family
UniProt Gene Name
SAP30L
UniProt Synonym Gene Names
NS4ATP2
UniProt Entry Name
SP30L_HUMAN
Uniprot Description
SAP30L: Involved in the functional recruitment of the class 1 Sin3-histone deacetylase complex (HDAC) to the nucleolus. Belongs to the SAP30 family.
Protein type: Nucleolus
Chromosomal Location of Human Ortholog: 5q33.2
Cellular Component: nucleolus; nucleoplasm; nucleus
Molecular Function: histone deacetylase activity; protein binding
Research Articles on SAP30L
Similar Products
Product Notes
The SAP30L sap30l (Catalog #AAA1270668) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacggct tcagcacgga ggaggacagc cgcgaagggc cccccgccgc cccagctgcc gccgccccgg gctacggcca gagctgctgc ctcatcgagg acggcgagcg ctgcgtccgg cccgcgggca acgcctcctt cagcaagagg gtccagaaga gcatctcgca gaagaaactc aagctggaca tcgacaagag cgtaaggcac ctatatatct gtgattttca caaaaatttc atccagagtg tccgaaataa aaggaagagg aagacaagtg acgatggcgg agattctccc gagcacgaca ctgacattcc tgaggttgat ctgttccagc tgcaggtgaa caccctacga cgttataaac gacactacaa gttgcagacc agaccaggct tcaataaggc ccagttagca gaaactgtga gtcgacactt caggaacata cctgtgaatg aaaaagagac ccttgcctac ttcatctaca tggtgaagag taacaagagt agactggacc agaaatcgga gggtggcaag cagcttgagt ga. It is sometimes possible for the material contained within the vial of "SAP30L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
