RUSC1 cdna clone
RUSC1 cDNA Clone
Gene Names
RUSC1; NESCA
Synonyms
RUSC1; RUSC1 cDNA Clone; RUSC1 cdna clone
Sequence
atggcagaagcccagagtgggactggtcagctgcaggagcagaagaaaggtcttctgatagccgtcagcgtctccgttgataaaatcatctcgcatttcggggccgcccggaacttggtgcagaaggcccagttgggtgatagccggctgagcccggatgtggggcacctggtgctgaccaccctctgcccggccctccacgccctggtggcggacgggctgaagcctttccggaaggacctcatcaccgggcagcgcaggagcagcccctggagcgtggtggaggcgtcggtgaagccaggctccagcacccgctcccttggaaccctgtatagccaggtcagccgtctagccccgctgagcagcagccgtagccgcttccatgcctttatcctgggcctcctcaacaccaagcagttggagctgtggttttccagtctccaggaagatgcaggcctgctctccctcctgtacctgccaacaggatttttctccctggcccgcggtggttgtccctccctgtccacagagctgctgctcctgctgcagccattgtcggtgctcactttccacctggacctgctctttgagcaccaccaccacctgcccctgggcccacctcaggcccctgcccctccaggcccacctccagctctgcagcagactatgcaagccatgctgcactttgggggccggctggcccagagccttcgggggacttccaaggaagctgcttcagacccctctgactctccaaaccttcccacaccagggagctggtgggagcagttgacccaggcctcccgggtctatgcctctgggggcactgagggctttcctctttcccgatgggcaccggggcgtcatgggactgcagctgaagaaggtgcacaggagagacccctgcccacagatgagatggcaccaggcaggggcctctggttgggaagactatttggagtgcctgggggccccgcagaaaatgagaatggagccctaaagtccaggagaccatctagctggctgcccccgacagtgagtgtgttggctcttgtgaagcggggggcacctcccgagatgccttctcctcaggagcttgaggcctcagcacccaggatggtgcaaacccatagggcagtgcgggctctctgtgatcacactgctgcaagacctgaccagttgagcttccggcgtggggaagtgctgcgtgtcatcaccacagtggatgaggactggctccgctgtgggcgggatggcatggagggtctggtgcctgtggggtatacctcccttgttctgtag
Sequence Length
1302
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
85,216 Da
NCBI Official Full Name
Homo sapiens RUN and SH3 domain containing 1, mRNA
NCBI Official Synonym Full Names
RUN and SH3 domain containing 1
NCBI Official Symbol
RUSC1
NCBI Official Synonym Symbols
NESCA
NCBI Protein Information
RUN and SH3 domain-containing protein 1
UniProt Protein Name
RUN and SH3 domain-containing protein 1
Protein Family
UniProt Gene Name
RUSC1
UniProt Synonym Gene Names
NESCA; Nesca
UniProt Entry Name
RUSC1_HUMAN
Uniprot Description
RUSC1: Putative signaling adapter which may play a role in neuronal differentiation. May be involved in regulation of NGF- dependent neurite outgrowth. Proposed to play a role in neuronal vesicular trafficking, specifically involving pre-synaptic membrane proteins. Seems to be involved in signaling pathways that are regulated by the prolonged activation of MAPK. Can regulate the polyubiquitination of IKBKG and thus may be involved in regulation of the NF-kappa-B pathway. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Adaptor/scaffold
Chromosomal Location of Human Ortholog: 1q21-q22
Cellular Component: cytoplasmic vesicle; early endosome; Golgi apparatus; microtubule cytoskeleton
Molecular Function: actin binding; protein binding; SH3/SH2 adaptor activity
Biological Process: protein polyubiquitination
Research Articles on RUSC1
Similar Products
Product Notes
The RUSC1 rusc1 (Catalog #AAA1272435) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaag cccagagtgg gactggtcag ctgcaggagc agaagaaagg tcttctgata gccgtcagcg tctccgttga taaaatcatc tcgcatttcg gggccgcccg gaacttggtg cagaaggccc agttgggtga tagccggctg agcccggatg tggggcacct ggtgctgacc accctctgcc cggccctcca cgccctggtg gcggacgggc tgaagccttt ccggaaggac ctcatcaccg ggcagcgcag gagcagcccc tggagcgtgg tggaggcgtc ggtgaagcca ggctccagca cccgctccct tggaaccctg tatagccagg tcagccgtct agccccgctg agcagcagcc gtagccgctt ccatgccttt atcctgggcc tcctcaacac caagcagttg gagctgtggt tttccagtct ccaggaagat gcaggcctgc tctccctcct gtacctgcca acaggatttt tctccctggc ccgcggtggt tgtccctccc tgtccacaga gctgctgctc ctgctgcagc cattgtcggt gctcactttc cacctggacc tgctctttga gcaccaccac cacctgcccc tgggcccacc tcaggcccct gcccctccag gcccacctcc agctctgcag cagactatgc aagccatgct gcactttggg ggccggctgg cccagagcct tcgggggact tccaaggaag ctgcttcaga cccctctgac tctccaaacc ttcccacacc agggagctgg tgggagcagt tgacccaggc ctcccgggtc tatgcctctg ggggcactga gggctttcct ctttcccgat gggcaccggg gcgtcatggg actgcagctg aagaaggtgc acaggagaga cccctgccca cagatgagat ggcaccaggc aggggcctct ggttgggaag actatttgga gtgcctgggg gccccgcaga aaatgagaat ggagccctaa agtccaggag accatctagc tggctgcccc cgacagtgag tgtgttggct cttgtgaagc ggggggcacc tcccgagatg ccttctcctc aggagcttga ggcctcagca cccaggatgg tgcaaaccca tagggcagtg cgggctctct gtgatcacac tgctgcaaga cctgaccagt tgagcttccg gcgtggggaa gtgctgcgtg tcatcaccac agtggatgag gactggctcc gctgtgggcg ggatggcatg gagggtctgg tgcctgtggg gtatacctcc cttgttctgt ag. It is sometimes possible for the material contained within the vial of "RUSC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
