Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RTN4RL2 cdna clone

RTN4RL2 cDNA Clone

Gene Names
RTN4RL2; NgR2; NGRH1
Synonyms
RTN4RL2; RTN4RL2 cDNA Clone; RTN4RL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgcccgggctcaggcgcctgctgcaagctcccgcctcggcctgcctcctgctgatgctcctggccctgcccctggcggcccccagctgccccatgctctgcacctgctactcatccccgcccaccgtgagctgccaggccaacaacttctcctctgtgccgctgtccctgccacccagcactcagcgactcttcctgcagaacaacctcatccgcacgctgcggccaggcacctttgggtccaacctgctcaccctgtggctcttctccaacaacctctccaccatctacccgggcactttccgccacttgcaagccctggaggagctggacctcggtgacaaccggcacctgcgctcgctggagcccgacaccttccagggcctggagcggctgcagtcgctgcatttgtaccgctgccagctcagcagcctgcccggcaacatcttccgaggcctggtcagcctgcagtacctctacctccaggagaacagcctgctccacctacaggatgacttgttcgcggacctggccaacctgagccacctcttcctccacgggaaccgcctgcggctgctcacagagcacgtgtttcgcggcctgggcagcctggaccggctgctgctgcacgggaaccggctgcagggcgtgcaccgcgcggccttccgcggcctcagccgcctcaccatcctctacctgttcaacaacagcctggcctcgctgcccggcgaggcgctcgccgacctgccctcgctcgagttcctgcggctcaacgctaacccctgggcgtgcgactgccgcgcgcggccgctctgggcctggttccagcgcgcgcgcgtgtccagctccgacgtgacctgcgccacccccccggagcgccagggccgagacctgcgcgcgctccgcgaggccgacttccaggcgtgtccgcccgcggcacccacgcggccgggcagccgcgcccgcggcaacagctcctccaaccacctgtacggggtggccgaggccggggcgcccccagccgatccctccaccctctaccgagatctgcctgccgaagactcgcgggggcgccagggcggggacgcgcctactgaggacgactactgggggggctacgggggtgaggaccagcgaggggagcagatgtgccccggcgctgcctgccaggcgcccccggactcccgaggccctgcgctctcggccgggctccccagccctctgctttgcctcctgctcctggtgccccaccacctctga
Sequence Length
1263
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,373 Da
NCBI Official Full Name
Homo sapiens reticulon 4 receptor-like 2, mRNA
NCBI Official Synonym Full Names
reticulon 4 receptor-like 2
NCBI Official Symbol
RTN4RL2
NCBI Official Synonym Symbols
NgR2; NGRH1
NCBI Protein Information
reticulon-4 receptor-like 2
UniProt Protein Name
Reticulon-4 receptor-like 2
Protein Family
UniProt Gene Name
RTN4RL2
UniProt Synonym Gene Names
NgR2
UniProt Entry Name
R4RL2_HUMAN

Uniprot Description

RTN4RL2: May play a role in regulating axonal regeneration and plasticity in the adult central nervous system. Belongs to the Nogo receptor family.

Protein type: Membrane protein, GPI anchor; Cell development/differentiation; Receptor, misc.

Chromosomal Location of Human Ortholog: 11q12.1

Cellular Component: anchored to plasma membrane; cell surface; cytoplasm

Molecular Function: protein kinase inhibitor activity; receptor activity

Biological Process: axon regeneration; cytokine and chemokine mediated signaling pathway; negative regulation of JAK-STAT cascade; negative regulation of protein kinase activity

Research Articles on RTN4RL2

Similar Products

Product Notes

The RTN4RL2 rtn4rl2 (Catalog #AAA1267232) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcccg ggctcaggcg cctgctgcaa gctcccgcct cggcctgcct cctgctgatg ctcctggccc tgcccctggc ggcccccagc tgccccatgc tctgcacctg ctactcatcc ccgcccaccg tgagctgcca ggccaacaac ttctcctctg tgccgctgtc cctgccaccc agcactcagc gactcttcct gcagaacaac ctcatccgca cgctgcggcc aggcaccttt gggtccaacc tgctcaccct gtggctcttc tccaacaacc tctccaccat ctacccgggc actttccgcc acttgcaagc cctggaggag ctggacctcg gtgacaaccg gcacctgcgc tcgctggagc ccgacacctt ccagggcctg gagcggctgc agtcgctgca tttgtaccgc tgccagctca gcagcctgcc cggcaacatc ttccgaggcc tggtcagcct gcagtacctc tacctccagg agaacagcct gctccaccta caggatgact tgttcgcgga cctggccaac ctgagccacc tcttcctcca cgggaaccgc ctgcggctgc tcacagagca cgtgtttcgc ggcctgggca gcctggaccg gctgctgctg cacgggaacc ggctgcaggg cgtgcaccgc gcggccttcc gcggcctcag ccgcctcacc atcctctacc tgttcaacaa cagcctggcc tcgctgcccg gcgaggcgct cgccgacctg ccctcgctcg agttcctgcg gctcaacgct aacccctggg cgtgcgactg ccgcgcgcgg ccgctctggg cctggttcca gcgcgcgcgc gtgtccagct ccgacgtgac ctgcgccacc cccccggagc gccagggccg agacctgcgc gcgctccgcg aggccgactt ccaggcgtgt ccgcccgcgg cacccacgcg gccgggcagc cgcgcccgcg gcaacagctc ctccaaccac ctgtacgggg tggccgaggc cggggcgccc ccagccgatc cctccaccct ctaccgagat ctgcctgccg aagactcgcg ggggcgccag ggcggggacg cgcctactga ggacgactac tgggggggct acgggggtga ggaccagcga ggggagcaga tgtgccccgg cgctgcctgc caggcgcccc cggactcccg aggccctgcg ctctcggccg ggctccccag ccctctgctt tgcctcctgc tcctggtgcc ccaccacctc tga. It is sometimes possible for the material contained within the vial of "RTN4RL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.