Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RRAGA cdna clone

RRAGA cDNA Clone

Gene Names
RRAGA; FIP1; RAGA; FIP-1
Synonyms
RRAGA; RRAGA cDNA Clone; RRAGA cdna clone
Ordering
For Research Use Only!
Sequence
atgccaaatacagccatgaagaaaaaggtgctgctgatggggaagagcgggtcggggaagaccagcatgaggtcgataatcttcgccaattacattgctcgcgacacccggcgcctgggggccaccattgacgtggaacactcccacgtccgattcctagggaacctggtgctgaacctgtgggactgtggcggtcaggacaccttcatggaaaattacttcaccagccagcgagacaatatcttccgtaacgtggaagttttgatttacgtgtttgacgtggagagccgcgaactggaaaaggacatgcattattaccagtcgtgtctggaggccatcctccagaactctcctgacgccaaaatcttctgcctggtgcacaaaatggatctggttcaggaggatcagcgtgacctgatttttaaagagcgagaggaagacctgaggcgtctgtctcgcccgctggagtgtgcttgttttcgaacgtccatctgggatgagacgctctacaaagcctggtccagcatcgtctaccagctgattcccaacgttcagcagctggagatgaacctcaggaattttgcccaaatcattgaggccgatgaagttctgctgttcgaaagagctacattcttggttatttcccactaccagtgcaaagagcagcgcgacgtccaccggtttgagaagatcagcaacatcatcaaacagttcaagctgagctgcagtaaattggccgcttccttccagagcatggaagttaggaattccaacttcgctgctttcatcgacatcttcacctcaaatacgtacgtgatggtggtcatgtcagatccgtcgatcccttctgcggccactctgatcaacattcgcaatgcccggaaacactttgagaagctggagagagtggatggccccaagcacagtctccttatgcgttga
Sequence Length
942
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,566 Da
NCBI Official Full Name
Homo sapiens Ras-related GTP binding A, mRNA
NCBI Official Synonym Full Names
Ras related GTP binding A
NCBI Official Symbol
RRAGA
NCBI Official Synonym Symbols
FIP1; RAGA; FIP-1
NCBI Protein Information
ras-related GTP-binding protein A
UniProt Protein Name
Ras-related GTP-binding protein A
UniProt Gene Name
RRAGA
UniProt Synonym Gene Names
RagA
UniProt Entry Name
RRAGA_HUMAN

Uniprot Description

RRAGA: Has guanine nucleotide-binding activity but undetectable intrinsic GTPase activity. Required for the amino acid-induced relocalization of mTORC1 to the lysosomes and its subsequent activation by the GTPase RHEB. This is a crucial step in the activation of the TOR signaling cascade by amino acids. Involved in the RCC1/Ran-GTPase pathway. May play a direct role in a TNF- alpha signaling pathway leading to induction of cell death. May alternatively act as a cellular target for adenovirus E3-14.7K, an inhibitor of TNF-alpha functions, thereby affecting cell death. Can occur as a homodimer, or form a heterodimer with RRAGC or RRAGD in a sequence-independent manner. Binds GTP. The GTP-bound form of RRAGA interacts with NOL8. Interacts with adenovirus E3 14.7 kDa protein. Ubiquitously expressed with highest levels of expression in skeletal muscle, heart, and brain. Belongs to the GTR/RAG GTP-binding protein family.

Protein type: G protein regulator, misc.

Chromosomal Location of Human Ortholog: 9p22.1

Cellular Component: cytoplasm; cytosol; Golgi apparatus; intracellular membrane-bound organelle; lysosomal membrane; lysosome; nucleus

Molecular Function: GTP binding; GTPase activity; phosphoprotein binding; protein binding; protein heterodimerization activity; protein homodimerization activity; ubiquitin protein ligase binding

Biological Process: cell cycle arrest; cell death; cellular response to amino acid starvation; macroautophagy; negative regulation of autophagy; positive regulation of cytolysis; virus-host interaction

Research Articles on RRAGA

Similar Products

Product Notes

The RRAGA rraga (Catalog #AAA1267868) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccaaata cagccatgaa gaaaaaggtg ctgctgatgg ggaagagcgg gtcggggaag accagcatga ggtcgataat cttcgccaat tacattgctc gcgacacccg gcgcctgggg gccaccattg acgtggaaca ctcccacgtc cgattcctag ggaacctggt gctgaacctg tgggactgtg gcggtcagga caccttcatg gaaaattact tcaccagcca gcgagacaat atcttccgta acgtggaagt tttgatttac gtgtttgacg tggagagccg cgaactggaa aaggacatgc attattacca gtcgtgtctg gaggccatcc tccagaactc tcctgacgcc aaaatcttct gcctggtgca caaaatggat ctggttcagg aggatcagcg tgacctgatt tttaaagagc gagaggaaga cctgaggcgt ctgtctcgcc cgctggagtg tgcttgtttt cgaacgtcca tctgggatga gacgctctac aaagcctggt ccagcatcgt ctaccagctg attcccaacg ttcagcagct ggagatgaac ctcaggaatt ttgcccaaat cattgaggcc gatgaagttc tgctgttcga aagagctaca ttcttggtta tttcccacta ccagtgcaaa gagcagcgcg acgtccaccg gtttgagaag atcagcaaca tcatcaaaca gttcaagctg agctgcagta aattggccgc ttccttccag agcatggaag ttaggaattc caacttcgct gctttcatcg acatcttcac ctcaaatacg tacgtgatgg tggtcatgtc agatccgtcg atcccttctg cggccactct gatcaacatt cgcaatgccc ggaaacactt tgagaagctg gagagagtgg atggccccaa gcacagtctc cttatgcgtt ga. It is sometimes possible for the material contained within the vial of "RRAGA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.