Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPSA cdna clone

RPSA cDNA Clone

Gene Names
RPSA; SA; LBP; LRP; p40; 67LR; ICAS; lamR; 37LRP; LAMBR; LAMR1; LRP/LR; LBP/p40; NEM/1CHD4
Synonyms
RPSA; RPSA cDNA Clone; RPSA cdna clone
Ordering
For Research Use Only!
Sequence
atgtccggagcccttgatgtcctgcaaatgaaggaggaggatgtccttaagttccttgcagcaggaacccacttaggtggcaccaatcttgacttccagatggaacagtacatctataaaaggaaaagtgatggcatctatatcataaatctcaagaggacctgggagaagcttctgctggcagctcgtgcaattgttgccattgaaaaccctgctgatgtcagtgttatatcctccaggaatactggccagagggctgtgctgaagtttgctgctgccactggagccactccaattgctggccgcttcactcctggaaccttcactaaccagatccaggcagccttccgggagccacggcttcttgtggttactgaccccagggctgaccaccagcctctcacggaggcatcttatgttaacctacctaccattgcgctgtgtaacacagattctcctctgcgctatgtggacattgccatcccatgcaacaacaagggagctcactcagtgggtttgatgtggtggatgctggctcgggaagttctgcgcatgcgtggcaccatttcccgtgaacacccatgggaggtcatgcctgatctgtacttctacagagatcctgaagagattgaaaaagaagggcaggctgctgctgagaaggcagtgaccaaggaggaatttcagggtgaatggactgctcccgctcctgagttcactgctactcagcctgaggttgcagactggtctgaaggtgtacaggtgccctctgtgcctattcagcaattccctactgaagactggagcgctcagcctgccacggaagactggtctgcagctcccactgctcaggccactgaatgggtaggagcaaccactgactggtcttaa
Sequence Length
888
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,854 Da
NCBI Official Full Name
Homo sapiens ribosomal protein SA, mRNA
NCBI Official Synonym Full Names
ribosomal protein SA
NCBI Official Symbol
RPSA
NCBI Official Synonym Symbols
SA; LBP; LRP; p40; 67LR; ICAS; lamR; 37LRP; LAMBR; LAMR1; LRP/LR; LBP/p40; NEM/1CHD4
NCBI Protein Information
40S ribosomal protein SA
UniProt Protein Name
40S ribosomal protein SA
Protein Family
UniProt Gene Name
RPSA
UniProt Synonym Gene Names
37LRP; LRP/LR; 67LR; LamR; LBP/p40
UniProt Entry Name
RSSA_HUMAN

NCBI Description

Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Many of the effects of laminin are mediated through interactions with cell surface receptors. These receptors include members of the integrin family, as well as non-integrin laminin-binding proteins. This gene encodes a high-affinity, non-integrin family, laminin receptor 1. This receptor has been variously called 67 kD laminin receptor, 37 kD laminin receptor precursor (37LRP) and p40 ribosome-associated protein. The amino acid sequence of laminin receptor 1 is highly conserved through evolution, suggesting a key biological function. It has been observed that the level of the laminin receptor transcript is higher in colon carcinoma tissue and lung cancer cell line than their normal counterparts. Also, there is a correlation between the upregulation of this polypeptide in cancer cells and their invasive and metastatic phenotype. Multiple copies of this gene exist, however, most of them are pseudogenes thought to have arisen from retropositional events. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

RPSA: Required for the assembly and/or stability of the 40S ribosomal subunit. Required for the processing of the 20S rRNA- precursor to mature 18S rRNA in a late step of the maturation of 40S ribosomal subunits. Also functions as a cell surface receptor for laminin. Plays a role in cell adhesion to the basement membrane and in the consequent activation of signaling transduction pathways. May play a role in cell fate determination and tissue morphogenesis. Acts as a PPP1R16B-dependent substrate of PPP1CA. Also acts as a receptor for several other ligands, including the pathogenic prion protein, viruses, and bacteria. Belongs to the ribosomal protein S2P family.

Protein type: Ribosomal

Chromosomal Location of Human Ortholog: 3p22.2

Cellular Component: cytoplasm; cytosol; membrane; nucleoplasm; nucleus; plasma membrane

Molecular Function: protein binding; ribosome binding; structural constituent of ribosome

Biological Process: endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA); endonucleolytic cleavage to generate mature 3'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA); mRNA catabolic process, nonsense-mediated decay; ribosomal small subunit assembly and maintenance; rRNA export from nucleus; rRNA processing; SRP-dependent cotranslational protein targeting to membrane; translation; translational initiation; viral transcription

Disease: Asplenia, Isolated Congenital

Research Articles on RPSA

Similar Products

Product Notes

The RPSA rpsa (Catalog #AAA1278109) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccggag cccttgatgt cctgcaaatg aaggaggagg atgtccttaa gttccttgca gcaggaaccc acttaggtgg caccaatctt gacttccaga tggaacagta catctataaa aggaaaagtg atggcatcta tatcataaat ctcaagagga cctgggagaa gcttctgctg gcagctcgtg caattgttgc cattgaaaac cctgctgatg tcagtgttat atcctccagg aatactggcc agagggctgt gctgaagttt gctgctgcca ctggagccac tccaattgct ggccgcttca ctcctggaac cttcactaac cagatccagg cagccttccg ggagccacgg cttcttgtgg ttactgaccc cagggctgac caccagcctc tcacggaggc atcttatgtt aacctaccta ccattgcgct gtgtaacaca gattctcctc tgcgctatgt ggacattgcc atcccatgca acaacaaggg agctcactca gtgggtttga tgtggtggat gctggctcgg gaagttctgc gcatgcgtgg caccatttcc cgtgaacacc catgggaggt catgcctgat ctgtacttct acagagatcc tgaagagatt gaaaaagaag ggcaggctgc tgctgagaag gcagtgacca aggaggaatt tcagggtgaa tggactgctc ccgctcctga gttcactgct actcagcctg aggttgcaga ctggtctgaa ggtgtacagg tgccctctgt gcctattcag caattcccta ctgaagactg gagcgctcag cctgccacgg aagactggtc tgcagctccc actgctcagg ccactgaatg ggtaggagca accactgact ggtcttaa. It is sometimes possible for the material contained within the vial of "RPSA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.