Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPS6 cdna clone

RPS6 cDNA Clone

Gene Names
RPS6; S6
Synonyms
RPS6; RPS6 cDNA Clone; RPS6 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagctgaacatctccttcccagccactggctgccagaaactcattgaagtggacgatgaacgcaaacttcgtactttctatgagaagcgtatggccacagaagttgctgctgacgctctgggtgaagaatggaagggttatgtggtccgaatcagtggtgggaacgacaaacaaggtttccccatgaagcagggtgtcttgacccatggccgtgtccgcctgctactgagtaaggggcattcctgttacagaccaaggagaactggagaaagaaagagaaaatcagttcgtggttgcattgtggatgcaaatctgagcgttctcaacttggttattgtaaaaaaaggagagaaggatattcctggactgactgatactacagtgcctcgccgcctgggccccaaaagagctagcagaatccgcaaacttttcaatctctctaaagaagatgatgtccgccagtatgttgtaagaaagcccttaaataaagaaggtaagaaacctaggaccaaagcacccaagattcagcgtcttgttactccacgtgtcctgcagcacaaacggcggcgtattgctctgaagaagcagcgtaccaagaaaaataaagaagaggctgcagaatatgctaaacttttggccaagagaatgaaggaggctagggagaagcgccaggaacaaattgcgaagagacgcagactttcctctctgcgagcttctacttctaagtctgaatccagtcagaaataa
Sequence Length
750
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,681 Da
NCBI Official Full Name
Homo sapiens ribosomal protein S6, mRNA
NCBI Official Synonym Full Names
ribosomal protein S6
NCBI Official Symbol
RPS6
NCBI Official Synonym Symbols
S6
NCBI Protein Information
40S ribosomal protein S6
UniProt Protein Name
40S ribosomal protein S6
Protein Family
UniProt Gene Name
RPS6
UniProt Entry Name
RS6_HUMAN

NCBI Description

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a cytoplasmic ribosomal protein that is a component of the 40S subunit. The protein belongs to the S6E family of ribosomal proteins. It is the major substrate of protein kinases in the ribosome, with subsets of five C-terminal serine residues phosphorylated by different protein kinases. Phosphorylation is induced by a wide range of stimuli, including growth factors, tumor-promoting agents, and mitogens. Dephosphorylation occurs at growth arrest. The protein may contribute to the control of cell growth and proliferation through the selective translation of particular classes of mRNA. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Uniprot Description

S6: May play an important role in controlling cell growth and proliferation through the selective translation of particular classes of mRNA. Belongs to the ribosomal protein S6e family.

Protein type: Translation

Chromosomal Location of Human Ortholog: 9p21

Cellular Component: cytoplasm; cytosol; dendrite; membrane; nucleolus; nucleoplasm; nucleus; ribonucleoprotein complex; small ribosomal subunit

Molecular Function: protein binding; protein kinase binding

Biological Process: glucose homeostasis; mRNA catabolic process, nonsense-mediated decay; positive regulation of apoptosis; ribosomal small subunit biogenesis and assembly; rRNA processing; SRP-dependent cotranslational protein targeting to membrane; TOR signaling pathway; translation; translational initiation; viral transcription

Research Articles on RPS6

Similar Products

Product Notes

The RPS6 rps6 (Catalog #AAA1276633) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagctga acatctcctt cccagccact ggctgccaga aactcattga agtggacgat gaacgcaaac ttcgtacttt ctatgagaag cgtatggcca cagaagttgc tgctgacgct ctgggtgaag aatggaaggg ttatgtggtc cgaatcagtg gtgggaacga caaacaaggt ttccccatga agcagggtgt cttgacccat ggccgtgtcc gcctgctact gagtaagggg cattcctgtt acagaccaag gagaactgga gaaagaaaga gaaaatcagt tcgtggttgc attgtggatg caaatctgag cgttctcaac ttggttattg taaaaaaagg agagaaggat attcctggac tgactgatac tacagtgcct cgccgcctgg gccccaaaag agctagcaga atccgcaaac ttttcaatct ctctaaagaa gatgatgtcc gccagtatgt tgtaagaaag cccttaaata aagaaggtaa gaaacctagg accaaagcac ccaagattca gcgtcttgtt actccacgtg tcctgcagca caaacggcgg cgtattgctc tgaagaagca gcgtaccaag aaaaataaag aagaggctgc agaatatgct aaacttttgg ccaagagaat gaaggaggct agggagaagc gccaggaaca aattgcgaag agacgcagac tttcctctct gcgagcttct acttctaagt ctgaatccag tcagaaataa. It is sometimes possible for the material contained within the vial of "RPS6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.