Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPS27A cdna clone

RPS27A cDNA Clone

Gene Names
RPS27A; UBC; S27A; CEP80; UBA80; HEL112; UBCEP1; UBCEP80
Synonyms
RPS27A; RPS27A cDNA Clone; RPS27A cdna clone
Ordering
For Research Use Only!
Sequence
atgcagattttcgtgaaaacccttacggggaagaccatcaccctcgaggttgaaccctcggatacgatagaaaatgtaaaggccaagatccaggataaggaaggaattcctcctgatcagcagagactgatctttgctggcaagcagctggaagatggacgtactttgtctgactacaatattcaaaaggagtctactcttcatcttgtgttgagacttcgtggtggtgctaagaaaaggaagaagaagtcttacaccactcccaagaagaataagcacaagagaaagaaggttaagctggctgtcctgaaatattataaggtggatgagaatggcaaaattagtcgccttcgtcgagagtgcccttctgatgaatgtggtgctggggtgtttatggcaagtcactttgacagacattattgtggcaaatgttgtctgacttactgtttcaacaaaccagaagacaagtaa
Sequence Length
471
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,965 Da
NCBI Official Full Name
Homo sapiens ribosomal protein S27a, mRNA
NCBI Official Synonym Full Names
ribosomal protein S27a
NCBI Official Symbol
RPS27A
NCBI Official Synonym Symbols
UBC; S27A; CEP80; UBA80; HEL112; UBCEP1; UBCEP80
NCBI Protein Information
ubiquitin-40S ribosomal protein S27a
UniProt Protein Name
Ubiquitin-40S ribosomal protein S27a
Protein Family
UniProt Gene Name
RPS27A
UniProt Synonym Gene Names
UBA80; UBCEP1
UniProt Entry Name
RS27A_HUMAN

NCBI Description

Ubiquitin, a highly conserved protein that has a major role in targeting cellular proteins for degradation by the 26S proteosome, is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin fused to an unrelated protein. This gene encodes a fusion protein consisting of ubiquitin at the N terminus and ribosomal protein S27a at the C terminus. When expressed in yeast, the protein is post-translationally processed, generating free ubiquitin monomer and ribosomal protein S27a. Ribosomal protein S27a is a component of the 40S subunit of the ribosome and belongs to the S27AE family of ribosomal proteins. It contains C4-type zinc finger domains and is located in the cytoplasm. Pseudogenes derived from this gene are present in the genome. As with ribosomal protein S27a, ribosomal protein L40 is also synthesized as a fusion protein with ubiquitin; similarly, ribosomal protein S30 is synthesized as a fusion protein with the ubiquitin-like protein fubi. Multiple alternatively spliced transcript variants that encode the same proteins have been identified.[provided by RefSeq, Sep 2008]

Research Articles on RPS27A

Similar Products

Product Notes

The RPS27A rps27a (Catalog #AAA1276613) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagattt tcgtgaaaac ccttacgggg aagaccatca ccctcgaggt tgaaccctcg gatacgatag aaaatgtaaa ggccaagatc caggataagg aaggaattcc tcctgatcag cagagactga tctttgctgg caagcagctg gaagatggac gtactttgtc tgactacaat attcaaaagg agtctactct tcatcttgtg ttgagacttc gtggtggtgc taagaaaagg aagaagaagt cttacaccac tcccaagaag aataagcaca agagaaagaa ggttaagctg gctgtcctga aatattataa ggtggatgag aatggcaaaa ttagtcgcct tcgtcgagag tgcccttctg atgaatgtgg tgctggggtg tttatggcaa gtcactttga cagacattat tgtggcaaat gttgtctgac ttactgtttc aacaaaccag aagacaagta a. It is sometimes possible for the material contained within the vial of "RPS27A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.