RPP38 cdna clone
RPP38 cDNA Clone
Synonyms
RPP38; RPP38 cDNA Clone; RPP38 cdna clone
Sequence
atggctgcagctcctcaagcaccggggcggggatctctccgtaagacgagacctctggttgtgaagacgtcgttgaacaacccatacatcatccgctggagcgctctggagagcgaggatatgcacttcatcctacagacgcttgaggacaggcttaaagctattggacttcagaagattgaagataagaagaaaaagaacaaaacaccttttctgaaaaaagaaagcagagagaaatgcagcattgctgttgatattagtgagaatctgaaggagaagaaaacagatgctaagcagcaagtgtcagggtggacgcctgcacacgtcaggaagcagcttgccattggcgttaacgaagttaccagagccctggaaaggagggaactgctgttagttctggtgtgtaaatcagtcaagcctgccatgatcacctcacacttgattcagttaagcctaagcagaagtgtccctgcctgtcaggtcccccggctcagtgagagaatcgcccccgtcattggcttaaaatgtgttctagccttggcgttcaaaaagaacaccactgactttgtggacgaagtaagagccatcatccccagagtccccagtttaagtgtaccatggcttcaagacagaattgaagattctggggaaaatttagagactgaacctctggaaagccaagacagagagcttttggacacttcatttgaagatctgtcaaaacctaagagaaagcttgctgacggtcggcaggcttctgtaacattacaaccccttaaaataaagaaactgattccaaaccctaataagataaggaaaccacccaaaagtaaaaaagctactccaaagtaa
Sequence Length
852
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,834 Da
NCBI Official Full Name
Homo sapiens ribonuclease P/MRP 38kDa subunit, mRNA
NCBI Official Synonym Full Names
ribonuclease P/MRP subunit p38
NCBI Official Symbol
RPP38
NCBI Protein Information
ribonuclease P protein subunit p38
UniProt Protein Name
Ribonuclease P protein subunit p38
Protein Family
UniProt Gene Name
RPP38
UniProt Synonym Gene Names
RNaseP protein p38
UniProt Entry Name
RPP38_HUMAN
Uniprot Description
RPP38: Component of ribonuclease P, a protein complex that generates mature tRNA molecules by cleaving their 5'-ends. RPP38 may associate transiently with RNase P RNA as a factor involved in the transport of H1 RNA to the putative site of its assembly in the cell, the nucleolus. Belongs to the ribosomal protein L7Ae family.
Protein type: EC 3.1.26.5; Ribonuclease; Nucleolus
Chromosomal Location of Human Ortholog: 10p13
Cellular Component: nucleolar ribonuclease P complex; nucleolus; nucleoplasm; nucleus
Molecular Function: protein binding
Biological Process: rRNA processing; tRNA 5'-leader removal
Research Articles on RPP38
Similar Products
Product Notes
The RPP38 rpp38 (Catalog #AAA1273750) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcag ctcctcaagc accggggcgg ggatctctcc gtaagacgag acctctggtt gtgaagacgt cgttgaacaa cccatacatc atccgctgga gcgctctgga gagcgaggat atgcacttca tcctacagac gcttgaggac aggcttaaag ctattggact tcagaagatt gaagataaga agaaaaagaa caaaacacct tttctgaaaa aagaaagcag agagaaatgc agcattgctg ttgatattag tgagaatctg aaggagaaga aaacagatgc taagcagcaa gtgtcagggt ggacgcctgc acacgtcagg aagcagcttg ccattggcgt taacgaagtt accagagccc tggaaaggag ggaactgctg ttagttctgg tgtgtaaatc agtcaagcct gccatgatca cctcacactt gattcagtta agcctaagca gaagtgtccc tgcctgtcag gtcccccggc tcagtgagag aatcgccccc gtcattggct taaaatgtgt tctagccttg gcgttcaaaa agaacaccac tgactttgtg gacgaagtaa gagccatcat ccccagagtc cccagtttaa gtgtaccatg gcttcaagac agaattgaag attctgggga aaatttagag actgaacctc tggaaagcca agacagagag cttttggaca cttcatttga agatctgtca aaacctaaga gaaagcttgc tgacggtcgg caggcttctg taacattaca accccttaaa ataaagaaac tgattccaaa ccctaataag ataaggaaac cacccaaaag taaaaaagct actccaaagt aa. It is sometimes possible for the material contained within the vial of "RPP38, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
