Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPAP2 cdna clone

RPAP2 cDNA Clone

Gene Names
RPAP2; Rtr1; C1orf82
Synonyms
RPAP2; RPAP2 cDNA Clone; RPAP2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggacttcgctgggccgtcttctgccggccgcaaggccggggctccccgctgctctcgaaaagccgcaggtactaaacagacaagtactttgaaacaagaagatgcttctaaaaggaaagctgaactagaagcagctgtgagaaagaagattgaatttgagagaaaagctctacatattgttgaacagcttttagaggagaatattacagaagagttcctaatggagtgtgggaggttcattacacctgctcactacagtgatgtcgtggatgaacgttctattgtcaaactctgtggttatcctttatgtcagaagaagctgggaattgtaccaaaacagaaatataaaatttctaccaaaaccaataaagtctatgatattactgaaagaaagtctttttgcagcaatttttgttatcaagcatctaagttttttgaagcacaaattcccaaaactccagtatgggttcgagaagaagagaggcatcctgattttcaactgctaaaggaagaacaaagtggccattctggagaagaagtacagttatgcagtaaagccattaaaacatcagatatcgacaatcctagccactttgaaaagcaatatgaatctagttcttctagcactcacagtgatagtagcagtgacaatgagcaagactttgtttcctccattctaccaggaaacagaccaaattcaacaaatattagaccacagctgcaccaaaaaagcataatgaaaaagaaagctggtcacaaagctaactccaaacacaaagacaaagaacagacagtagtagatgtcactgagcagttaggcgattgcaaattagatagtcaggagaaagatgctacatgtgaacttcctttacagaaagtaaatactcagagttcttcaaatagcactttgcctgaaagattaaaagcgtcagaaaattctgaaagtgaatacagtaggtcagaaataactctagtaggcataagtaagaaaagtgcagagcattttaagagaaaatttgccaaatcaaaccaagtgtctaggtcagtgtctagttcagtgcaggtgtgtcctgaagttggaaagagaaacttacttaaagttttgaaggagactttgattgagtggaagacagaagaaacattgaggtttttgtatggccagaattatgcttctgtgtgtctgaaacccgaagcctctctggttaaagaagaacttgatgaagatgacataatctcagatccagatagtcatttccctgcctggagggaatctcagaacagcttggatgagtctttaccttttaggggctcaggtacagccattaaaccactgccaagttacgagaatttgaaaaaagaaactgaaaagttaaatctgaggatcagggagttttacagaggacggtatgttttgggtgaagaaaccaccaaatcacaagactcagaagagcatgattccacctttccactgatagactcaagttcccagaaccagattagaaaacgcatcgtacttgaaaagttgagtaaagtgttgcctgggcttctggttcctcttcagattacattgggagatatttacacacaacttaaaaatcttgttcgaactttcaggttaacaaatagaaatattatacacaaacctgcggaatggactttaattgctatggtgttgctgtcattactgaccccaattcttggcattcagaaacattctcaggaaggtatggtgtttacacggtttctagacaccctccttgaagaattacatctaaaaaatgaagaccttgaaagtctaaccatcatatttagaaccagctgtttaccagagtga
Sequence Length
1839
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
66,473 Da
NCBI Official Full Name
Homo sapiens RNA polymerase II associated protein 2, mRNA
NCBI Official Synonym Full Names
RNA polymerase II associated protein 2
NCBI Official Symbol
RPAP2
NCBI Official Synonym Symbols
Rtr1; C1orf82
NCBI Protein Information
putative RNA polymerase II subunit B1 CTD phosphatase RPAP2
UniProt Protein Name
Putative RNA polymerase II subunit B1 CTD phosphatase RPAP2
UniProt Gene Name
RPAP2
UniProt Synonym Gene Names
C1orf82
UniProt Entry Name
RPAP2_HUMAN

Uniprot Description

RPAP2: Protein phosphatase that displays CTD phosphatase activity and regulates transcription of snRNA genes. Recognizes and binds phosphorylated 'Ser-7' of the C-terminal heptapeptide repeat domain (CTD) of the largest RNA polymerase II subunit POLR2A, and mediates dephosphorylation of 'Ser-5' of the CTD, thereby promoting transcription of snRNA genes. Belongs to the RPAP2 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; EC 3.1.3.16; Protein phosphatase, Ser/Thr (non-receptor)

Chromosomal Location of Human Ortholog: 1p22.1

Cellular Component: cytoplasm; DNA-directed RNA polymerase II, holoenzyme; nucleolus; nucleoplasm; nucleus

Molecular Function: CTD phosphatase activity; protein serine/threonine phosphatase activity

Biological Process: snRNA transcription; snRNA transcription from RNA polymerase II promoter

Research Articles on RPAP2

Similar Products

Product Notes

The RPAP2 rpap2 (Catalog #AAA1275550) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggact tcgctgggcc gtcttctgcc ggccgcaagg ccggggctcc ccgctgctct cgaaaagccg caggtactaa acagacaagt actttgaaac aagaagatgc ttctaaaagg aaagctgaac tagaagcagc tgtgagaaag aagattgaat ttgagagaaa agctctacat attgttgaac agcttttaga ggagaatatt acagaagagt tcctaatgga gtgtgggagg ttcattacac ctgctcacta cagtgatgtc gtggatgaac gttctattgt caaactctgt ggttatcctt tatgtcagaa gaagctggga attgtaccaa aacagaaata taaaatttct accaaaacca ataaagtcta tgatattact gaaagaaagt ctttttgcag caatttttgt tatcaagcat ctaagttttt tgaagcacaa attcccaaaa ctccagtatg ggttcgagaa gaagagaggc atcctgattt tcaactgcta aaggaagaac aaagtggcca ttctggagaa gaagtacagt tatgcagtaa agccattaaa acatcagata tcgacaatcc tagccacttt gaaaagcaat atgaatctag ttcttctagc actcacagtg atagtagcag tgacaatgag caagactttg tttcctccat tctaccagga aacagaccaa attcaacaaa tattagacca cagctgcacc aaaaaagcat aatgaaaaag aaagctggtc acaaagctaa ctccaaacac aaagacaaag aacagacagt agtagatgtc actgagcagt taggcgattg caaattagat agtcaggaga aagatgctac atgtgaactt cctttacaga aagtaaatac tcagagttct tcaaatagca ctttgcctga aagattaaaa gcgtcagaaa attctgaaag tgaatacagt aggtcagaaa taactctagt aggcataagt aagaaaagtg cagagcattt taagagaaaa tttgccaaat caaaccaagt gtctaggtca gtgtctagtt cagtgcaggt gtgtcctgaa gttggaaaga gaaacttact taaagttttg aaggagactt tgattgagtg gaagacagaa gaaacattga ggtttttgta tggccagaat tatgcttctg tgtgtctgaa acccgaagcc tctctggtta aagaagaact tgatgaagat gacataatct cagatccaga tagtcatttc cctgcctgga gggaatctca gaacagcttg gatgagtctt taccttttag gggctcaggt acagccatta aaccactgcc aagttacgag aatttgaaaa aagaaactga aaagttaaat ctgaggatca gggagtttta cagaggacgg tatgttttgg gtgaagaaac caccaaatca caagactcag aagagcatga ttccaccttt ccactgatag actcaagttc ccagaaccag attagaaaac gcatcgtact tgaaaagttg agtaaagtgt tgcctgggct tctggttcct cttcagatta cattgggaga tatttacaca caacttaaaa atcttgttcg aactttcagg ttaacaaata gaaatattat acacaaacct gcggaatgga ctttaattgc tatggtgttg ctgtcattac tgaccccaat tcttggcatt cagaaacatt ctcaggaagg tatggtgttt acacggtttc tagacaccct ccttgaagaa ttacatctaa aaaatgaaga ccttgaaagt ctaaccatca tatttagaac cagctgttta ccagagtga. It is sometimes possible for the material contained within the vial of "RPAP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.