Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ROPN1L cdna clone

ROPN1L cDNA Clone

Gene Names
ROPN1L; ASP; RSPH11
Synonyms
ROPN1L; ROPN1L cDNA Clone; ROPN1L cdna clone
Ordering
For Research Use Only!
Sequence
atgccgcttcccgacaccatgttctgcgctcagcagatccacattcccccggagctgccggacatcctgaagcaattcaccaaggctgccatccgcacccagccggccgacgtgctgcggtggtccgcgggctatttttcagctctgtcgagaggagatccacttcctgtaaaggacagaatggaaatgcccacggcaacccagaaaacagacacaggcctgactcaaggactcctgaaagttttgcacaagcagtgtcaccacaagcggtatgtggaattaacagatcttgagcagaagtggaagaacttgtgcctgccgaaggaaaaattcaaagcgctcttacaactggatccttgtgaaaacaaaatcaagtggataaactttttagcgcttggatgcagcatgcttggtgggtccttgaacactgcgctgaagcacctgtgcgagatcctcacggacgatcgggagggcgggcccgctcgcatccccttcaagacgttttcctacgtttaccgctacttggccagattagactcagatgtgtctcccttggagacggaatcctaccttgcctctctaaaggaaaatatagacgccaggaagaacggcatgataggtctttcagatttcttctttccaaagaggaaacttttagaaagcattgaaaactctgaagatgtaggccattaa
Sequence Length
693
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,107 Da
NCBI Official Full Name
Homo sapiens ropporin 1-like, mRNA
NCBI Official Synonym Full Names
rhophilin associated tail protein 1 like
NCBI Official Symbol
ROPN1L
NCBI Official Synonym Symbols
ASP; RSPH11
NCBI Protein Information
ropporin-1-like protein
UniProt Protein Name
Ropporin-1-like protein
Protein Family
UniProt Gene Name
ROPN1L
UniProt Synonym Gene Names
ASP; ROPN1-like protein
UniProt Entry Name
ROP1L_HUMAN

NCBI Description

This gene encodes a member of the ropporin family. The encoded protein is present in sperm and interacts with A-kinase anchoring protein, AKAP3, through the amphipathic helix region of AKAP3. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2014]

Uniprot Description

ROPN1L: a member of the ropporin family. The encoded protein is a sperm protein. It interacts with A-kinase anchoring protein, AKAP3, through the amphipathic helix region of AKAP3. Type II regulatory subunit of cAMP-dependent protein kinase (PKARII) also binds to this helix domain of AKAP3, which allows PKARII to be targeted to specific subcellular compartments. It is suggested that sperm contains several proteins that bind to AKAPs in a manner similar to PKARII, and this encoded protein may be one of them. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2011]

Protein type: Protein kinase, regulatory subunit

Chromosomal Location of Human Ortholog: 5p15.2

Cellular Component: cytoplasm

Molecular Function: protein binding

Research Articles on ROPN1L

Similar Products

Product Notes

The ROPN1L ropn1l (Catalog #AAA1268163) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgcttc ccgacaccat gttctgcgct cagcagatcc acattccccc ggagctgccg gacatcctga agcaattcac caaggctgcc atccgcaccc agccggccga cgtgctgcgg tggtccgcgg gctatttttc agctctgtcg agaggagatc cacttcctgt aaaggacaga atggaaatgc ccacggcaac ccagaaaaca gacacaggcc tgactcaagg actcctgaaa gttttgcaca agcagtgtca ccacaagcgg tatgtggaat taacagatct tgagcagaag tggaagaact tgtgcctgcc gaaggaaaaa ttcaaagcgc tcttacaact ggatccttgt gaaaacaaaa tcaagtggat aaacttttta gcgcttggat gcagcatgct tggtgggtcc ttgaacactg cgctgaagca cctgtgcgag atcctcacgg acgatcggga gggcgggccc gctcgcatcc ccttcaagac gttttcctac gtttaccgct acttggccag attagactca gatgtgtctc ccttggagac ggaatcctac cttgcctctc taaaggaaaa tatagacgcc aggaagaacg gcatgatagg tctttcagat ttcttctttc caaagaggaa acttttagaa agcattgaaa actctgaaga tgtaggccat taa. It is sometimes possible for the material contained within the vial of "ROPN1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.