RNGTT cdna clone
RNGTT cDNA Clone
Gene Names
RNGTT; HCE; HCE1; hCAP; CAP1A
Synonyms
RNGTT; RNGTT cDNA Clone; RNGTT cdna clone
Sequence
atggctcacaacaagatcccgccgcggtggctgaactgtccccggcgcggccagccggtggcaggaagattcttacctctgaagacaatgttaggaccaagatatgatagtcaagttgctgaagaaaatcggttccatcccagcatgctctcaaattacctaaagagcctaaaggttaaaatgggcttgttggtggacctgacaaatacttcaaggttctatgaccgaaatgacatagaaaaagaaggaatcaaatatataaaacttcagtgtaaaggacatggtgagtgccctaccactgagaatactgagacctttattcgtctgtgtgagcggtttaatgaaagaaatccacctgaacttataggtgttcattgtactcatggcttcaatcgcactggtttcctcatatgtgcctttttggtggagaaaatggattggagtatcgaagcagcagttgctacttttgcccaagccagaccaccaggaatctacaagggtgattatttgaaggaactttttcgtcggtatggtgacatagaggaagcaccacccccacctctattgccagattggtgttttgaggatgatgaagacgaagatgaggatgaggatggaaagaaggaatcagaaaccgggtcaagtgcttcttttggcaaaaggagaaaagaacggttaaaactgggcgctattttcttggaaggtgttactgttaaaggtgtaactcaagtaacaacacaaccaaagttaggagaggtacagcagaagtgtcatcaattctgtggctgggaagggtctggattccctggagcacagcctgtttccatggacaagcaaaatattaaacttttagacctgaagccatacaaagtaagctggaaagcagatggtactcggtacatgatgttgattgatggcacaaatgaagtttttatgattgatagagacaattcagtatttcatgtttcaaatctggaatttccatttcgtaaagatcttcgtatgcatttatcaaatactctcttggatggcgagatgattattgacagagtaaatggacaggctgttcctagatatttgatatatgacataattaaattcaattcacagcccgttggagattgtgattttaatgttcgtctgcagtgtatagaacgagaaattataagtcctcgacacgaaaaaatgaagactgggctcattgacaaaacacaggaaccatttagcgtcagaaataagccgttttttgacatctgtacttcaagaaagctacttgaaggaaattttgccaaagaagtgagccatgaaatggatggacttatttttcagcctactggaaaatacaaacctggtcgatgtgatgatattttgaaatggaagcctcccagtctgaattctgtggattttcgtctaaaaataacaagaatgggaggagaagggttacttcctcagaatgttggcctcctgtatgttggaggttatgaaagaccctttgcacaaatcaaggtgacaaaagagctgaaacagtatgacaacaaaattatagaatgcaaatttgagaacaacagctgggtcttcatgagacagagaacagacaaaagttttcctaatgcctacaacactgccatggctgtgtgtaacagcatctcaaaccctgtcaccaaggagatgctgtttgagttcatcgacagatgtactgcagcttctcaaggacagaagcgaaaacatcatctggaccctgacacggagctcatgccaccaccacctcccaaaagaccacaccctttaacctaa
Sequence Length
1794
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
61,705 Da
NCBI Official Full Name
Homo sapiens RNA guanylyltransferase and 5'-phosphatase, mRNA
NCBI Official Synonym Full Names
RNA guanylyltransferase and 5'-phosphatase
NCBI Official Symbol
RNGTT
NCBI Official Synonym Symbols
HCE; HCE1; hCAP; CAP1A
NCBI Protein Information
mRNA-capping enzyme
UniProt Protein Name
mRNA-capping enzyme
UniProt Gene Name
RNGTT
UniProt Synonym Gene Names
CAP1A; TPase; GTase
UniProt Entry Name
MCE1_HUMAN
Uniprot Description
RNGTT: a bifunctional mRNA capping enzyme with RNA 5'-triphosphatase activity in the N-terminal part and mRNA guanyltransferase activity in the C-terminal part. Catalyzes the first two steps of cap formation: by removing the gamma-phosphate from the 5'-triphosphate end of nascent mRNA to yield a diphosphate end, and by transferring the gmp moiety of GTP to the 5'-diphosphate terminus. Four alternatively spliced human isoforms have been described. Isoform 1 and isoform 4 are expressed in cerebrum, cerebellum, thyroid, lung, heart, liver, kidney, spleen, large intestine, testis, skin and muscle. Isoforms 2, 3 and 4 lack mRNA 5'-guanylyltransferase activity due to disruptions of the GTPase domain.
Protein type: Phosphatase (non-protein); EC 3.1.3.33; EC 2.7.7.50; Transferase; Motility/polarity/chemotaxis
Chromosomal Location of Human Ortholog: 6q16
Cellular Component: nucleoplasm; nucleus
Molecular Function: mRNA guanylyltransferase activity; polynucleotide 5'-phosphatase activity; RNA guanylyltransferase activity; triphosphatase activity
Biological Process: mRNA capping; RNA processing; transcription from RNA polymerase II promoter
Research Articles on RNGTT
Similar Products
Product Notes
The RNGTT rngtt (Catalog #AAA1268978) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcaca acaagatccc gccgcggtgg ctgaactgtc cccggcgcgg ccagccggtg gcaggaagat tcttacctct gaagacaatg ttaggaccaa gatatgatag tcaagttgct gaagaaaatc ggttccatcc cagcatgctc tcaaattacc taaagagcct aaaggttaaa atgggcttgt tggtggacct gacaaatact tcaaggttct atgaccgaaa tgacatagaa aaagaaggaa tcaaatatat aaaacttcag tgtaaaggac atggtgagtg ccctaccact gagaatactg agacctttat tcgtctgtgt gagcggttta atgaaagaaa tccacctgaa cttataggtg ttcattgtac tcatggcttc aatcgcactg gtttcctcat atgtgccttt ttggtggaga aaatggattg gagtatcgaa gcagcagttg ctacttttgc ccaagccaga ccaccaggaa tctacaaggg tgattatttg aaggaacttt ttcgtcggta tggtgacata gaggaagcac cacccccacc tctattgcca gattggtgtt ttgaggatga tgaagacgaa gatgaggatg aggatggaaa gaaggaatca gaaaccgggt caagtgcttc ttttggcaaa aggagaaaag aacggttaaa actgggcgct attttcttgg aaggtgttac tgttaaaggt gtaactcaag taacaacaca accaaagtta ggagaggtac agcagaagtg tcatcaattc tgtggctggg aagggtctgg attccctgga gcacagcctg tttccatgga caagcaaaat attaaacttt tagacctgaa gccatacaaa gtaagctgga aagcagatgg tactcggtac atgatgttga ttgatggcac aaatgaagtt tttatgattg atagagacaa ttcagtattt catgtttcaa atctggaatt tccatttcgt aaagatcttc gtatgcattt atcaaatact ctcttggatg gcgagatgat tattgacaga gtaaatggac aggctgttcc tagatatttg atatatgaca taattaaatt caattcacag cccgttggag attgtgattt taatgttcgt ctgcagtgta tagaacgaga aattataagt cctcgacacg aaaaaatgaa gactgggctc attgacaaaa cacaggaacc atttagcgtc agaaataagc cgttttttga catctgtact tcaagaaagc tacttgaagg aaattttgcc aaagaagtga gccatgaaat ggatggactt atttttcagc ctactggaaa atacaaacct ggtcgatgtg atgatatttt gaaatggaag cctcccagtc tgaattctgt ggattttcgt ctaaaaataa caagaatggg aggagaaggg ttacttcctc agaatgttgg cctcctgtat gttggaggtt atgaaagacc ctttgcacaa atcaaggtga caaaagagct gaaacagtat gacaacaaaa ttatagaatg caaatttgag aacaacagct gggtcttcat gagacagaga acagacaaaa gttttcctaa tgcctacaac actgccatgg ctgtgtgtaa cagcatctca aaccctgtca ccaaggagat gctgtttgag ttcatcgaca gatgtactgc agcttctcaa ggacagaagc gaaaacatca tctggaccct gacacggagc tcatgccacc accacctccc aaaagaccac accctttaac ctaa. It is sometimes possible for the material contained within the vial of "RNGTT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
