Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF31 cdna clone

RNF31 cDNA Clone

Gene Names
RNF31; HOIP; ZIBRA
Synonyms
RNF31; RNF31 cDNA Clone; RNF31 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgggaagaaggcctccagctagtgagcatgatccgggaaggggaagccgcaggtgcctgtccagaggagatcttctcggctctgcagtactcgggcactgaggtgcctctgcagtggttgcgctcagaactgccctacgtcctggagatggtggctgagctggctggacagcaggaccctgggctgggtgccttttcctgtcaggaggcccggagagcctggctggatcgtcatggcaaccttgatgaagctgtggaggagtgtgtgaggaccaggcgaaggaaggtgcaggagctccagtctctaggctttgggcctgaggaggggtctctccaggcattgttccagcacggaggtgatgtgtcacgggccctgactgagctacagcgccaacgcctagagcccttccgccagcgcctctgggacagtggccctgagcccaccccttcctgggatgggccagacaagcagagcctggtcaggcggcttttggcagtctacgcactccccagctggggccgggcagagctggcactgtcactgctgcaggagacacccaggaactatgagttgggggatgtggtagaagctgtgaggcacagccaggaccgggccttcctgcgccgcttgcttgcccaggagtgtgccgtgtgtggctgggccctgccccacaaccggatgcaggccctgacttcctgtgagtgcaccatctgtcctgactgcttccgccagcacttcaccatcgccttgaaggagaagcacatcacagacatggtgtgccctgcctgtggccgccccgacctcaccgatgacacacagttgctcagctacttctctacccttgacatccagcttcgcgagagcctagagccagatgcctatgcgttgttccataagaagctgaccgagggtgtgctgatgcgggaccccaagttcttgtggtgtgcccagtgctcctttggcttcatatatgagcgtgagcagctggaggcaacttgtccccagtgtcaccagaccttctgtgtgcgctgcaagcgccagtgggaggagcagcaccgaggtcggagctgtgaggacttccagaactggaaacgcatgaacgacccagaataccaggcccagggcctagcaatgtatcttcaggaaaacggcattgactgccccaaatgcaagttctcgtacgccctggcccgaggaggctgcatgcactttcactgtacccagtgccgccaccagttctgcagcggctgctacaatgccttttacgccaagaataaatgtccagagcctaactgcagggtgaaaaagtccctgcacggccaccaccctcgagactgcctcttctacctgcgggactggactgctctccggcttcagaagctgctacaggacaataacgtcatgtttaatacagagcctccagctggggcccgggcagtccctggaggcggctgccgagtgatagagcagaaggaggttcccaatgggctcagggacgaagcttgtggcaaggaaactccagctggctatgccggcctgtgccaggcacactacaaagagtatcttgtgagcctcatcaatgcccactcgctggacccagccaccttgtatgaggtggaagagctggagacggccactgagcgctacctgcacgtacgcccccagcctttggctggagaggatccccctgcttaccaggcccgcttgttacagaagctgacagaagaggtacccttgggacagagtatcccccgcaggcggaagtag
Sequence Length
1770
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
102,496 Da
NCBI Official Full Name
Homo sapiens ring finger protein 31, mRNA
NCBI Official Synonym Full Names
ring finger protein 31
NCBI Official Symbol
RNF31
NCBI Official Synonym Symbols
HOIP; ZIBRA
NCBI Protein Information
E3 ubiquitin-protein ligase RNF31
UniProt Protein Name
E3 ubiquitin-protein ligase RNF31
UniProt Gene Name
RNF31
UniProt Synonym Gene Names
ZIBRA; HOIP
UniProt Entry Name
RNF31_HUMAN

NCBI Description

The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The encoded protein is the E3 ubiquitin-protein ligase component of the linear ubiquitin chain assembly complex. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]

Uniprot Description

RNF31: E3 ubiquitin-protein ligase component of the LUBAC complex which conjugates linear ('M-1'-linked) polyubiquitin chains to substrates and plays a key role in NF-kappa-B activation and regulation of inflammation. LUBAC conjugates linear polyubiquitin to IKBKG and RIPK1 and is involved in activation of the canonical NF-kappa-B and the JNK signaling pathways. Linear ubiquitination mediated by the LUBAC complex interferes with TNF- induced cell death and thereby prevents inflammation. LUBAC is proposed to be recruited to the TNF-R1 signaling complex (TNF-RSC) following polyubiquitination of TNF-RSC components by BIRC2 and/or BIRC3 and to conjugate linear polyubiquitin to IKBKG and possibly other components contributing to the stability of the complex. Binds polyubiquitin of different linkage types. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Ligase; Ubiquitin ligase; EC 6.3.2.-; EC 6.3.2.19; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 14q11.2

Cellular Component: cytosol; internal side of plasma membrane

Molecular Function: protein binding; ubiquitin binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: activation of NF-kappaB transcription factor; I-kappaB kinase/NF-kappaB cascade; positive regulation of I-kappaB kinase/NF-kappaB cascade; protein polyubiquitination; T cell receptor signaling pathway

Research Articles on RNF31

Similar Products

Product Notes

The RNF31 rnf31 (Catalog #AAA1277274) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgggaag aaggcctcca gctagtgagc atgatccggg aaggggaagc cgcaggtgcc tgtccagagg agatcttctc ggctctgcag tactcgggca ctgaggtgcc tctgcagtgg ttgcgctcag aactgcccta cgtcctggag atggtggctg agctggctgg acagcaggac cctgggctgg gtgccttttc ctgtcaggag gcccggagag cctggctgga tcgtcatggc aaccttgatg aagctgtgga ggagtgtgtg aggaccaggc gaaggaaggt gcaggagctc cagtctctag gctttgggcc tgaggagggg tctctccagg cattgttcca gcacggaggt gatgtgtcac gggccctgac tgagctacag cgccaacgcc tagagccctt ccgccagcgc ctctgggaca gtggccctga gcccacccct tcctgggatg ggccagacaa gcagagcctg gtcaggcggc ttttggcagt ctacgcactc cccagctggg gccgggcaga gctggcactg tcactgctgc aggagacacc caggaactat gagttggggg atgtggtaga agctgtgagg cacagccagg accgggcctt cctgcgccgc ttgcttgccc aggagtgtgc cgtgtgtggc tgggccctgc cccacaaccg gatgcaggcc ctgacttcct gtgagtgcac catctgtcct gactgcttcc gccagcactt caccatcgcc ttgaaggaga agcacatcac agacatggtg tgccctgcct gtggccgccc cgacctcacc gatgacacac agttgctcag ctacttctct acccttgaca tccagcttcg cgagagccta gagccagatg cctatgcgtt gttccataag aagctgaccg agggtgtgct gatgcgggac cccaagttct tgtggtgtgc ccagtgctcc tttggcttca tatatgagcg tgagcagctg gaggcaactt gtccccagtg tcaccagacc ttctgtgtgc gctgcaagcg ccagtgggag gagcagcacc gaggtcggag ctgtgaggac ttccagaact ggaaacgcat gaacgaccca gaataccagg cccagggcct agcaatgtat cttcaggaaa acggcattga ctgccccaaa tgcaagttct cgtacgccct ggcccgagga ggctgcatgc actttcactg tacccagtgc cgccaccagt tctgcagcgg ctgctacaat gccttttacg ccaagaataa atgtccagag cctaactgca gggtgaaaaa gtccctgcac ggccaccacc ctcgagactg cctcttctac ctgcgggact ggactgctct ccggcttcag aagctgctac aggacaataa cgtcatgttt aatacagagc ctccagctgg ggcccgggca gtccctggag gcggctgccg agtgatagag cagaaggagg ttcccaatgg gctcagggac gaagcttgtg gcaaggaaac tccagctggc tatgccggcc tgtgccaggc acactacaaa gagtatcttg tgagcctcat caatgcccac tcgctggacc cagccacctt gtatgaggtg gaagagctgg agacggccac tgagcgctac ctgcacgtac gcccccagcc tttggctgga gaggatcccc ctgcttacca ggcccgcttg ttacagaagc tgacagaaga ggtacccttg ggacagagta tcccccgcag gcggaagtag. It is sometimes possible for the material contained within the vial of "RNF31, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.