Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

RNF24 cdna clone

RNF24 cDNA Clone

Gene Names
RNF24; G1L
Synonyms
RNF24; RNF24 cDNA Clone; RNF24 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgagctcggatttcccacattacaacttcaggatgcctaatattggattccagaatctgcctctcaacatatatattgtggtttttggtactgctatatttgtcttcatccttagtttactcttctgttgctacttgattaggctaagacatcaagcacacaaagaattttatgcctacaaacaggttatattaaaagagaaagtaaaagaattgaatttacatgagctctgtgcagtgtgcctagaagacttcaagcctcgagatgagttggggatttgcccatgtaagcacgccttccacagaaagtgccttattaagtggctggaggttcgtaaagtgtgtcccctgtgcaacatgccagttctacagctggcccagttgcacagtaagcaggaccgtggaccccctcaggggccccttcctggggcagagaacattgtatag
Sequence Length
447
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,402 Da
NCBI Official Full Name
Homo sapiens ring finger protein 24, mRNA
NCBI Official Synonym Full Names
ring finger protein 24
NCBI Official Symbol
RNF24
NCBI Official Synonym Symbols
G1L
NCBI Protein Information
RING finger protein 24
UniProt Protein Name
RING finger protein 24
Protein Family
UniProt Gene Name
RNF24
UniProt Entry Name
RNF24_HUMAN

NCBI Description

This gene encodes an integral membrane protein that contains a RING-type zinc finger. The encoded protein may interact with multiple transient receptor potential cation channel subfamily C (TRPC) proteins and regulate the trafficking and insertion of these proteins into the plasma membrane. [provided by RefSeq, Mar 2016]

Uniprot Description

RNF24: May play a role in TRPCs intracellular trafficking. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 20p13

Molecular Function: protein binding

Biological Process: proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process

Research Articles on RNF24

Similar Products

Product Notes

The RNF24 rnf24 (Catalog #AAA1273521) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagctcgg atttcccaca ttacaacttc aggatgccta atattggatt ccagaatctg cctctcaaca tatatattgt ggtttttggt actgctatat ttgtcttcat ccttagttta ctcttctgtt gctacttgat taggctaaga catcaagcac acaaagaatt ttatgcctac aaacaggtta tattaaaaga gaaagtaaaa gaattgaatt tacatgagct ctgtgcagtg tgcctagaag acttcaagcc tcgagatgag ttggggattt gcccatgtaa gcacgccttc cacagaaagt gccttattaa gtggctggag gttcgtaaag tgtgtcccct gtgcaacatg ccagttctac agctggccca gttgcacagt aagcaggacc gtggaccccc tcaggggccc cttcctgggg cagagaacat tgtatag. It is sometimes possible for the material contained within the vial of "RNF24, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual