Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF219 cdna clone

RNF219 cDNA Clone

Gene Names
RNF219; C13orf7
Synonyms
RNF219; RNF219 cDNA Clone; RNF219 cdna clone
Ordering
For Research Use Only!
Sequence
atgctaagccatacggtcaggaagcatcttcggaaaactagacttgaattactacacaaagaatatgaggacgaaatagattgtttacagaaagaagtagaagagcttaagagtaaaaatctcagcttggagtcacagatcaaaactattctggatcctttaaccttggtgcagggcaaccaaaatgaagacaaacatctagtcacagataatccaagtaaaattaacccagaaactgtagcagagtggaagaaaaaactcagaacagctaatgaaatctatgaaaaagtgaaagatgatgtggataagctaaaggaggcaaataaaaaattgaaattggaaaatggtggtctggtgagggagaatttacgactgaaggctgaagttgataacagatcacctcaaaagtttggaaggtttgcagttgctgctcttcagtccaaagtagaacagtatgagcgtgaaaccaatcgcctcaagaaagccctggaacgaagtgataagtatatagaggaactagaatctcaagttgcacagctaaaaaattcaagtgaagagaaagaagctatgaattccatttgccagacagcactttctgcagatggcaaagggagcaaaggcagtgaggaggatgtggtgtcaaagaatcaaggcgatagtgccagaaagcagcctggctcatccacctccagttcttctcacctagcgaagccttccagcagcagactgtgtgacaccagttctgcaaggcaggaaagtaccagcaaagcagaccttaactgttctaagaacaaagacctatatcaagaacaggtagaagtaatgttagatgtgacagatacaagtatggatacttatttggaaagagaatgggggaataaaccaagtgactgtgtaccctacaaagatgaagaactttatgatcttccagctccttgtactcctttgtcccttagttgccttcagctcagtactccagaaaatagagagagctctgtggtccaagcaggaggttccaaaaagcactcaaaccatctcagaaaattggtgtttgatgatttttgtgattcttcaaatgtttctaataaagattcttcagaagatgatataagtagaagtgaaaatgaaaagaaatcagaatgtttttcttccccaaagacaggattttgggactgttgttccacaagctatgcccaaaacttagattttgaaagttcagaggggaacacgatagcaaattctgttggagaaatatcttcaaaattgagtgagaaatcaggcttatgtttatccaaaaggttgaattctattcgctcttttgaaatgaaccggacaagaacatccagtgaagcatcgatggatgctgcttaccttgacaaaatctctgagttggattcaatgatgtcagagtcagacaacagcaagagcccttgtaataacggttttaagtcactggatttggatgggttatcaaagtcatctcaaggcagtgaatttcttgaggaacctgataagttggaagaaaaaactgagctaaacctttccaaaggttctctaactaatgatcagttagaaaatggaagtgaatggaaacccacttcttttttttctcctctctccatctga
Sequence Length
1626
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
81,116 Da
NCBI Official Full Name
Homo sapiens cDNA clone IMAGE:4838051, containing frame-shift errors
NCBI Official Synonym Full Names
ring finger protein 219
NCBI Official Symbol
RNF219
NCBI Official Synonym Symbols
C13orf7
NCBI Protein Information
RING finger protein 219
UniProt Protein Name
RING finger protein 219
Protein Family
UniProt Gene Name
RNF219
UniProt Synonym Gene Names
C13orf7
UniProt Entry Name
RN219_HUMAN

Uniprot Description

RNF219:

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 13q31.1

Molecular Function: protein binding

Similar Products

Product Notes

The RNF219 rnf219 (Catalog #AAA1275699) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctaagcc atacggtcag gaagcatctt cggaaaacta gacttgaatt actacacaaa gaatatgagg acgaaataga ttgtttacag aaagaagtag aagagcttaa gagtaaaaat ctcagcttgg agtcacagat caaaactatt ctggatcctt taaccttggt gcagggcaac caaaatgaag acaaacatct agtcacagat aatccaagta aaattaaccc agaaactgta gcagagtgga agaaaaaact cagaacagct aatgaaatct atgaaaaagt gaaagatgat gtggataagc taaaggaggc aaataaaaaa ttgaaattgg aaaatggtgg tctggtgagg gagaatttac gactgaaggc tgaagttgat aacagatcac ctcaaaagtt tggaaggttt gcagttgctg ctcttcagtc caaagtagaa cagtatgagc gtgaaaccaa tcgcctcaag aaagccctgg aacgaagtga taagtatata gaggaactag aatctcaagt tgcacagcta aaaaattcaa gtgaagagaa agaagctatg aattccattt gccagacagc actttctgca gatggcaaag ggagcaaagg cagtgaggag gatgtggtgt caaagaatca aggcgatagt gccagaaagc agcctggctc atccacctcc agttcttctc acctagcgaa gccttccagc agcagactgt gtgacaccag ttctgcaagg caggaaagta ccagcaaagc agaccttaac tgttctaaga acaaagacct atatcaagaa caggtagaag taatgttaga tgtgacagat acaagtatgg atacttattt ggaaagagaa tgggggaata aaccaagtga ctgtgtaccc tacaaagatg aagaacttta tgatcttcca gctccttgta ctcctttgtc ccttagttgc cttcagctca gtactccaga aaatagagag agctctgtgg tccaagcagg aggttccaaa aagcactcaa accatctcag aaaattggtg tttgatgatt tttgtgattc ttcaaatgtt tctaataaag attcttcaga agatgatata agtagaagtg aaaatgaaaa gaaatcagaa tgtttttctt ccccaaagac aggattttgg gactgttgtt ccacaagcta tgcccaaaac ttagattttg aaagttcaga ggggaacacg atagcaaatt ctgttggaga aatatcttca aaattgagtg agaaatcagg cttatgttta tccaaaaggt tgaattctat tcgctctttt gaaatgaacc ggacaagaac atccagtgaa gcatcgatgg atgctgctta ccttgacaaa atctctgagt tggattcaat gatgtcagag tcagacaaca gcaagagccc ttgtaataac ggttttaagt cactggattt ggatgggtta tcaaagtcat ctcaaggcag tgaatttctt gaggaacctg ataagttgga agaaaaaact gagctaaacc tttccaaagg ttctctaact aatgatcagt tagaaaatgg aagtgaatgg aaacccactt cttttttttc tcctctctcc atctga. It is sometimes possible for the material contained within the vial of "RNF219, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.