Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF213 cdna clone

RNF213 cDNA Clone

Gene Names
RNF213; ALO17; MYMY2; MYSTR; NET57; C17orf27; KIAA1618
Synonyms
RNF213; RNF213 cDNA Clone; RNF213 cdna clone
Ordering
For Research Use Only!
Sequence
atgaataatctcatcagccaagataagcgtatcagctctaaccctgtggccaaaataatatatggtgacccagtgaccttcctgccccacctgccccggaaaagtgtggtccattgctctaagatttggagctgcaggaaaagaattacagttgagtacctccagcacattgtggaacagaaaaatggcaaagaaagagtgcccatcctctggcatttcctgcagaaggaagcagagctgaggctggtaaagttcctgcctgagattttggccttgcaaagggatctagtgaagcagttccagaacgtccagcaagttgaatacagctccatcagaggcttcctcagcaagcacagctcagatgggttgaggcagctgcttcacaacaggatcacagtctttctgtccacatggaacaaactgaggagatcgcttgagacgaacggtgagatcaacctacccaaagactactgcagcactgacttggatctggacactgagtttgagatcctcttgccacgccgacggggcctgggcctctgtgctaccgctctcgtcagctacttgattcgcctacacaatgaaattgtctacgccgtggaaaaactctccaaggaaaacaacagctattccgtggatgccgccgaggtcactgaactgcatgtcatcagttatgaagtggagcgggacctgactccactgattctctccaactgccagtaccaggtggaggagggcagagagaccgtgcaggagttcgatctggagaagattcagcggcagatcgtcagccgcttcctccagggcaagccccggctgagcctcaagggaatacccactctggtgtacagacacgactggaactatgaacatctctttatggacatcaagaacaaaatggcacaggactccctccccagctcggtcattagtgccatcagtggacagctgcagtcctacagcgatgcctgtgaagtgctgtctgtcgtagaagtcactctggggtttctgagcacagctggtggggatccaaacatgcagctgaatgtgtatactcaagacatcctgcaaatgggtgatcagacgattcacgtgttaaaggccttaaacagatgccagttaaaacacaccattgccctctggcagttcctgtctgctcataagtctgaacagctgctgcggctgcacaaagagccatttggggaaatcagttcaaggtacaaagcggatctgagcccggaaaatgctaagctcctcagcacattcctaaatcagactggcctagacgccttcctgctagagctgcacgaaatgataatcttgaaactaaagaacccccaaacccaaaccgaggagcgcttccgccctcagtggagcctgagagacactctcgtaagttacatgcaaactaaagaaagtgaaattcttcctgaaatggcatctcagttcccagaagagatactgctcgccagctgtgtctcagtgtggaaaacagctgctgtgctgaaatggaatcgagaaatgagatag
Sequence Length
1530
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,260 Da
NCBI Official Full Name
Homo sapiens ring finger protein 213, mRNA
NCBI Official Synonym Full Names
ring finger protein 213
NCBI Official Symbol
RNF213
NCBI Official Synonym Symbols
ALO17; MYMY2; MYSTR; NET57; C17orf27; KIAA1618
NCBI Protein Information
E3 ubiquitin-protein ligase RNF213
UniProt Protein Name
E3 ubiquitin-protein ligase RNF213
UniProt Gene Name
RNF213
UniProt Entry Name
RN213_HUMAN

NCBI Description

This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]

Uniprot Description

RNF213: Probable E3 ubiquitin-protein ligase that may play a role in angiogenesis. May also have an ATPase activity. Defects in RNF213 are the cause of susceptibility to Moyamoya disease type 2 (MYMY2). A progressive cerebral angiopathy characterized by bilateral intracranial carotid artery stenosis and telangiectatic vessels in the region of the basal ganglia. The abnormal vessels resemble a 'puff of smoke' (moyamoya) on cerebral angiogram. Affected individuals can develop transient ischemic attacks and/or cerebral infarction, and rupture of the collateral vessels can cause intracranial hemorrhage. Hemiplegia of sudden onset and epileptic seizures constitute the prevailing presentation in childhood, while subarachnoid bleeding occurs more frequently in adults. A chromosomal aberration involving ALO17 is associated with anaplastic large-cell lymphoma (ALCL). Translocation t(2;17)(p23;q25) with ALK. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system; EC 6.3.2.-; Oncoprotein

Chromosomal Location of Human Ortholog: 17q25.3

Cellular Component: cytoplasm; cytosol; membrane; nucleolus

Molecular Function: ATPase activity; ubiquitin-protein ligase activity

Biological Process: angiogenesis; protein autoubiquitination; protein homooligomerization; protein polyubiquitination; protein ubiquitination; sprouting angiogenesis; ubiquitin-dependent protein catabolic process

Research Articles on RNF213

Similar Products

Product Notes

The RNF213 rnf213 (Catalog #AAA1277062) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaataatc tcatcagcca agataagcgt atcagctcta accctgtggc caaaataata tatggtgacc cagtgacctt cctgccccac ctgccccgga aaagtgtggt ccattgctct aagatttgga gctgcaggaa aagaattaca gttgagtacc tccagcacat tgtggaacag aaaaatggca aagaaagagt gcccatcctc tggcatttcc tgcagaagga agcagagctg aggctggtaa agttcctgcc tgagattttg gccttgcaaa gggatctagt gaagcagttc cagaacgtcc agcaagttga atacagctcc atcagaggct tcctcagcaa gcacagctca gatgggttga ggcagctgct tcacaacagg atcacagtct ttctgtccac atggaacaaa ctgaggagat cgcttgagac gaacggtgag atcaacctac ccaaagacta ctgcagcact gacttggatc tggacactga gtttgagatc ctcttgccac gccgacgggg cctgggcctc tgtgctaccg ctctcgtcag ctacttgatt cgcctacaca atgaaattgt ctacgccgtg gaaaaactct ccaaggaaaa caacagctat tccgtggatg ccgccgaggt cactgaactg catgtcatca gttatgaagt ggagcgggac ctgactccac tgattctctc caactgccag taccaggtgg aggagggcag agagaccgtg caggagttcg atctggagaa gattcagcgg cagatcgtca gccgcttcct ccagggcaag ccccggctga gcctcaaggg aatacccact ctggtgtaca gacacgactg gaactatgaa catctcttta tggacatcaa gaacaaaatg gcacaggact ccctccccag ctcggtcatt agtgccatca gtggacagct gcagtcctac agcgatgcct gtgaagtgct gtctgtcgta gaagtcactc tggggtttct gagcacagct ggtggggatc caaacatgca gctgaatgtg tatactcaag acatcctgca aatgggtgat cagacgattc acgtgttaaa ggccttaaac agatgccagt taaaacacac cattgccctc tggcagttcc tgtctgctca taagtctgaa cagctgctgc ggctgcacaa agagccattt ggggaaatca gttcaaggta caaagcggat ctgagcccgg aaaatgctaa gctcctcagc acattcctaa atcagactgg cctagacgcc ttcctgctag agctgcacga aatgataatc ttgaaactaa agaaccccca aacccaaacc gaggagcgct tccgccctca gtggagcctg agagacactc tcgtaagtta catgcaaact aaagaaagtg aaattcttcc tgaaatggca tctcagttcc cagaagagat actgctcgcc agctgtgtct cagtgtggaa aacagctgct gtgctgaaat ggaatcgaga aatgagatag. It is sometimes possible for the material contained within the vial of "RNF213, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.