RNF148 cdna clone
RNF148 cDNA Clone
Synonyms
RNF148; RNF148 cDNA Clone; RNF148 cdna clone
Sequence
atgagcttccttagaattaccccttcgacgcatagttctgtttcatctggacttttgaggcttagtatctttctactacttagctttcctgactcaaacggaaaagccatttggacagctcacctgaatataacatttcaggttggaaatgagatcacatcggaattaggagagagtggagtgttcgggaatcattctcctctggaaagggtgtctggtgtggtggcacttcctgaaggatggaatcagaatgcctgtcatcctttgaccaatttcagcaggcccaaacaggcagactcatggctggccctcatcgaacgtggaggctgtacttttacacataaaatcaacgtggcagcagagaagggagcaaatggggtgatcatctacaactatcaaggtacgggcagtaaagtatttcccatgtctcaccaggggacggaaaatatagtcgcggtgatgataagcaacctgaaaggcatggaaattttgcactcgattcagaaaggagtctatgtgacagtcatcattgaagtggggagaatgcacatgcagtgggtgagccattacatcatgtatctatttaccttcctggctgccacaattgcctacttttacttagattgcgtctggagacttacacctagagtgcccaattctttcaccaggaggcgaagtcaaataaagacagatgtgaagaaagctattgaccagcttcaactgcgagttctcaaagaaggggatgaggaattagacctaaatgaagacaactgtgttgtttgctttgacacatacaaaccccaagatgtagtacgcattttaacttgcaaacattttttccataaggcatgcattgacccctggcttttagcccataggacatgtcccatgtgcaagtgtgacatcctgaaaacttaa
Sequence Length
918
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
34,397 Da
NCBI Official Full Name
Homo sapiens ring finger protein 148, mRNA
NCBI Official Synonym Full Names
ring finger protein 148
NCBI Official Symbol
RNF148
NCBI Protein Information
RING finger protein 148
UniProt Protein Name
RING finger protein 148
Protein Family
UniProt Gene Name
RNF148
UniProt Entry Name
RN148_HUMAN
Uniprot Description
RNF148:
Protein type: Ubiquitin conjugating system; Membrane protein, integral
Chromosomal Location of Human Ortholog: 7q31.33
Research Articles on RNF148
Similar Products
Product Notes
The RNF148 rnf148 (Catalog #AAA1272511) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcttcc ttagaattac cccttcgacg catagttctg tttcatctgg acttttgagg cttagtatct ttctactact tagctttcct gactcaaacg gaaaagccat ttggacagct cacctgaata taacatttca ggttggaaat gagatcacat cggaattagg agagagtgga gtgttcggga atcattctcc tctggaaagg gtgtctggtg tggtggcact tcctgaagga tggaatcaga atgcctgtca tcctttgacc aatttcagca ggcccaaaca ggcagactca tggctggccc tcatcgaacg tggaggctgt acttttacac ataaaatcaa cgtggcagca gagaagggag caaatggggt gatcatctac aactatcaag gtacgggcag taaagtattt cccatgtctc accaggggac ggaaaatata gtcgcggtga tgataagcaa cctgaaaggc atggaaattt tgcactcgat tcagaaagga gtctatgtga cagtcatcat tgaagtgggg agaatgcaca tgcagtgggt gagccattac atcatgtatc tatttacctt cctggctgcc acaattgcct acttttactt agattgcgtc tggagactta cacctagagt gcccaattct ttcaccagga ggcgaagtca aataaagaca gatgtgaaga aagctattga ccagcttcaa ctgcgagttc tcaaagaagg ggatgaggaa ttagacctaa atgaagacaa ctgtgttgtt tgctttgaca catacaaacc ccaagatgta gtacgcattt taacttgcaa acattttttc cataaggcat gcattgaccc ctggctttta gcccatagga catgtcccat gtgcaagtgt gacatcctga aaacttaa. It is sometimes possible for the material contained within the vial of "RNF148, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
