Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF138 cdna clone

RNF138 cDNA Clone

Gene Names
RNF138; NARF; HSD-4; STRIN; hNARF
Synonyms
RNF138; RNF138 cDNA Clone; RNF138 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgaggacctctctgcggccacgtcctacaccgaagatgatttctactgccccgtctgtcaggaggtgctcaaaacgcccgtgcggaccacggcctgtcagcacgttttctgtagaaaatgtttcctgactgcaatgagggaaagcggagcacattgtcccctatgtcgtggaaatgtgactagaagagagagagcatgtcctgaacgggccttagaccttgaaaatataatgaggaagttttctggtagctgcagatgctgtgcaaaacagattaaattctatcgcatgagacatcattacaaatcttgtaagaagtatcaggatgaatatggtgtttcttctatcattccaaactttcagatctctcaagattcagtagggaacagcaataggagtgaaacatccacatctgataacacagaaacttaccaagagaatacaagttcttctggtcatcctacttttaagtgtcccctgtgtcaagaatcaaattttaccagacagcgtttactggatcactgtaacagtaatcacctatttcagatagttcctgtgacatgtcctatttgtgtgtctcttccttggggagatcctagccagattaccagaaatttcgttagtcatctaaatcagagacatcaatttgattatggagaatttgtgaatcttcagctagatgaagaaacccaataccaaactgctgttgaagaatcttttcaagtaaacatctga
Sequence Length
738
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,262 Da
NCBI Official Full Name
Homo sapiens ring finger protein 138, mRNA
NCBI Official Synonym Full Names
ring finger protein 138
NCBI Official Symbol
RNF138
NCBI Official Synonym Symbols
NARF; HSD-4; STRIN; hNARF
NCBI Protein Information
E3 ubiquitin-protein ligase RNF138
UniProt Protein Name
E3 ubiquitin-protein ligase RNF138
UniProt Gene Name
RNF138
UniProt Synonym Gene Names
hNARF
UniProt Entry Name
RN138_HUMAN

NCBI Description

The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]

Uniprot Description

RNF138: E3 ubiquitin-protein ligase. Together with NLK, involved in the ubiquitination and degradation of TCF/LEF. Also exhibits auto-ubiquitination activity in combination with UBE2K. May act as a negative regulator in the Wnt/beta-catenin-mediated signaling pathway. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.19; Ligase; Ubiquitin conjugating system; EC 6.3.2.-; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 18q12.1

Cellular Component: nucleus

Molecular Function: protein binding; protein kinase binding; single-stranded DNA binding; ubiquitin conjugating enzyme binding

Biological Process: double-strand break repair via homologous recombination; positive regulation of proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; protein ubiquitination

Research Articles on RNF138

Similar Products

Product Notes

The RNF138 rnf138 (Catalog #AAA1271706) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgagg acctctctgc ggccacgtcc tacaccgaag atgatttcta ctgccccgtc tgtcaggagg tgctcaaaac gcccgtgcgg accacggcct gtcagcacgt tttctgtaga aaatgtttcc tgactgcaat gagggaaagc ggagcacatt gtcccctatg tcgtggaaat gtgactagaa gagagagagc atgtcctgaa cgggccttag accttgaaaa tataatgagg aagttttctg gtagctgcag atgctgtgca aaacagatta aattctatcg catgagacat cattacaaat cttgtaagaa gtatcaggat gaatatggtg tttcttctat cattccaaac tttcagatct ctcaagattc agtagggaac agcaatagga gtgaaacatc cacatctgat aacacagaaa cttaccaaga gaatacaagt tcttctggtc atcctacttt taagtgtccc ctgtgtcaag aatcaaattt taccagacag cgtttactgg atcactgtaa cagtaatcac ctatttcaga tagttcctgt gacatgtcct atttgtgtgt ctcttccttg gggagatcct agccagatta ccagaaattt cgttagtcat ctaaatcaga gacatcaatt tgattatgga gaatttgtga atcttcagct agatgaagaa acccaatacc aaactgctgt tgaagaatct tttcaagtaa acatctga. It is sometimes possible for the material contained within the vial of "RNF138, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.