Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF135 cdna clone

RNF135 cDNA Clone

Gene Names
RNF135; L13; MMFD; REUL; Riplet
Synonyms
RNF135; RNF135 cDNA Clone; RNF135 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgggcctgggcctgggctccgccgttcccgtgtggctggccgaggacgacctcggctgcatcatctgccaggggctgctggactggcccgccacgctgccctgcggccacagcttctgccgccactgcctggaggccctgtggggcgcccgcgacgcccgccgctgggcctgccccacttgccgccagggcgccgcgcagcagccgcacctgcggaagaacacgctactgcaggacctggccgacaagtaccgccgcgccgcacgcgagatacaggcgggctccgaccctgcccactgcccctgcccgggctccagttccctctccagcgcggccgcgaggccccggcgccgcccggaactgcagcgggtggcagtagagaagagcatcacagaagttgctcaggagctgacagagctggtggaacatcttgtagacattgtcagaagcctgcagaatcagaggcccctatcagaatctggaccagacaacgaactgagcatcctgggcaaggctttttcttctggggtggatctttccatggcttctccaaagctggtgacttccgacacagctgcagggaaaatcagagatattctccatgacctagaagaaattcaggaaaaattacaagaaagcgtcacctggaaagaggctcctgaagcacaaatgcagggagaactcctggaagccccgtcttcctcctcatgcccattgcctgaccagagccaccctgcactcaggagagcttctcggtttgctcagtgggccatccatccaacctttaacttgaagagcctttcctgcagcctggaggtgtccaaggattcccgtacagtgactgtgtctcaccgcccacaaccctatcgctggagctgtgagaggttttctaccagccaggtcttatgttcccaggccctgtcttctggaaagcattactgggaagtggacactaggaattgcagccactgggcagttggggtggcttcctgggagatgagccgcgaccaggtcctgggaaggactatggactcttgttgtgtggaatggaaggggactagccagctctctgcatggcacatggtcaaggaaactgtccttggctcagacagacctggggtggtgggcatctggctgaaccttgaggagggaaagcttgccttctattcagtggacaatcaggagaagcttctgtatgagtgtaccatctctgcctcctctcctttgtaccctgccttctggctgtatggcttacatcctggaaattacctgataataaagcaagtaaaggtgtaa
Sequence Length
1299
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,989 Da
NCBI Official Full Name
Homo sapiens ring finger protein 135, mRNA
NCBI Official Synonym Full Names
ring finger protein 135
NCBI Official Symbol
RNF135
NCBI Official Synonym Symbols
L13; MMFD; REUL; Riplet
NCBI Protein Information
E3 ubiquitin-protein ligase RNF135
UniProt Protein Name
E3 ubiquitin-protein ligase RNF135
UniProt Gene Name
RNF135
UniProt Synonym Gene Names
REUL
UniProt Entry Name
RN135_HUMAN

NCBI Description

The protein encoded by this gene contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. This gene is located in a chromosomal region known to be frequently deleted in patients with neurofibromatosis. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]

Uniprot Description

RNF135: Acts as an E2-dependent E3 ubiquitin-protein ligase, involved in innate immune defense against viruses. Ubiquitinates DDX58 and is required for full activation of the DDX58 signaling resulting in interferon beta production. Defects in RNF135 are the cause of macrocephaly macrosomia facial dysmorphism syndrome (MMFD). MMFD is an autosomal dominant disorder characterized by the association of macrothrombocytopathy and progressive sensorineural hearing loss without renal dysfunction. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin ligase; DNA replication; EC 6.3.2.-; Calcium-binding; Ubiquitin conjugating system; Ligase

Chromosomal Location of Human Ortholog: 17q11.2

Cellular Component: cytoplasm; cytosol

Molecular Function: protein binding; ribonucleoprotein binding; ubiquitin-protein ligase activity

Biological Process: innate immune response; negative regulation of interferon type I production; positive regulation of interferon-beta production; protein ubiquitination; regulation of innate immune response

Disease: Macrocephaly, Macrosomia, Facial Dysmorphism Syndrome

Research Articles on RNF135

Similar Products

Product Notes

The RNF135 rnf135 (Catalog #AAA1270325) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgggcc tgggcctggg ctccgccgtt cccgtgtggc tggccgagga cgacctcggc tgcatcatct gccaggggct gctggactgg cccgccacgc tgccctgcgg ccacagcttc tgccgccact gcctggaggc cctgtggggc gcccgcgacg cccgccgctg ggcctgcccc acttgccgcc agggcgccgc gcagcagccg cacctgcgga agaacacgct actgcaggac ctggccgaca agtaccgccg cgccgcacgc gagatacagg cgggctccga ccctgcccac tgcccctgcc cgggctccag ttccctctcc agcgcggccg cgaggccccg gcgccgcccg gaactgcagc gggtggcagt agagaagagc atcacagaag ttgctcagga gctgacagag ctggtggaac atcttgtaga cattgtcaga agcctgcaga atcagaggcc cctatcagaa tctggaccag acaacgaact gagcatcctg ggcaaggctt tttcttctgg ggtggatctt tccatggctt ctccaaagct ggtgacttcc gacacagctg cagggaaaat cagagatatt ctccatgacc tagaagaaat tcaggaaaaa ttacaagaaa gcgtcacctg gaaagaggct cctgaagcac aaatgcaggg agaactcctg gaagccccgt cttcctcctc atgcccattg cctgaccaga gccaccctgc actcaggaga gcttctcggt ttgctcagtg ggccatccat ccaaccttta acttgaagag cctttcctgc agcctggagg tgtccaagga ttcccgtaca gtgactgtgt ctcaccgccc acaaccctat cgctggagct gtgagaggtt ttctaccagc caggtcttat gttcccaggc cctgtcttct ggaaagcatt actgggaagt ggacactagg aattgcagcc actgggcagt tggggtggct tcctgggaga tgagccgcga ccaggtcctg ggaaggacta tggactcttg ttgtgtggaa tggaagggga ctagccagct ctctgcatgg cacatggtca aggaaactgt ccttggctca gacagacctg gggtggtggg catctggctg aaccttgagg agggaaagct tgccttctat tcagtggaca atcaggagaa gcttctgtat gagtgtacca tctctgcctc ctctcctttg taccctgcct tctggctgta tggcttacat cctggaaatt acctgataat aaagcaagta aaggtgtaa. It is sometimes possible for the material contained within the vial of "RNF135, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.