Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF133 cdna clone

RNF133 cDNA Clone

Synonyms
RNF133; RNF133 cDNA Clone; RNF133 cdna clone
Ordering
For Research Use Only!
Sequence
atgcatctactcaaggttggcacttggagaaacaacactgcctcttcctggcttatgaagttcagtgttctttggcttgttagtcagaactgttgcagagcaagtgttgtttggatggcttatatgaacatatcatttcatgttgggaatcatgtgttgtcagagttgggagagactggagtctttggaagaagctccactttgaagagagtggcaggagttatagtgccaccagagggaaaaatccaaaatgcatgtaatcccaataccattttcagccgatcaaagtactcagagacctggcttgcacttattgaacggggaggttgtaccttcacacagaaaattaaagtggcaactgagaagggagccagtggagtgatcatctataacgttccaggtactggcaaccaggtgttccccatgtttcatcaggcatttgaagatgtcgttgtggttatgattggtaacttaaaaggcacggaaattttccatttaattaagaagggagttctcattacagccgtggttgaggtggggagaaagcacatcatctggatgaatcactatttggtctcttttgtgattgtcacaactgctaccttagcatatttcatcttttatcacattcatagactttgtttagcaaggattcagaaccggagatggcagcgattaacaacagatcttcagaacacatttggacaactccaacttcgagtagtaaaagagggggatgaagaaataaatccaaatggggatagctgcgtaatttgctttgaacgctataagcctaatgacatagttcgtattctgacttgtaaacattttttccacaagaattgcattgacccctggattttaccccatgggacatgccccatttgcaaatgtgatattcttaaagttttggggattcaagtggttgttgaaaatggaacagaacctttgcaagttctaatgtcaaatgaactgcctgaaaccttatcacctagtgaagaggagacaaataatgaagtttctcctgcaggaacctcagataaagtaatccatgtggaggagaaccctacttctcagaataatgacatccagcctcattcagtagtggaagatgttcatccttcaccttga
Sequence Length
1131
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,294 Da
NCBI Official Full Name
Homo sapiens ring finger protein 133, mRNA
NCBI Official Synonym Full Names
ring finger protein 133
NCBI Official Symbol
RNF133
NCBI Protein Information
E3 ubiquitin-protein ligase RNF133
UniProt Protein Name
E3 ubiquitin-protein ligase RNF133
UniProt Gene Name
RNF133
UniProt Entry Name
RN133_HUMAN

NCBI Description

The protein encoded by this gene contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. This gene has no intron. [provided by RefSeq, Jul 2008]

Uniprot Description

RNF133: Has E3 ubiquitin-protein ligase activity.

Protein type: EC 6.3.2.-; Membrane protein, integral; Ligase; EC 6.3.2.19; Ubiquitin conjugating system; Endoplasmic reticulum; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 7q31.32

Research Articles on RNF133

Similar Products

Product Notes

The RNF133 rnf133 (Catalog #AAA1270679) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcatctac tcaaggttgg cacttggaga aacaacactg cctcttcctg gcttatgaag ttcagtgttc tttggcttgt tagtcagaac tgttgcagag caagtgttgt ttggatggct tatatgaaca tatcatttca tgttgggaat catgtgttgt cagagttggg agagactgga gtctttggaa gaagctccac tttgaagaga gtggcaggag ttatagtgcc accagaggga aaaatccaaa atgcatgtaa tcccaatacc attttcagcc gatcaaagta ctcagagacc tggcttgcac ttattgaacg gggaggttgt accttcacac agaaaattaa agtggcaact gagaagggag ccagtggagt gatcatctat aacgttccag gtactggcaa ccaggtgttc cccatgtttc atcaggcatt tgaagatgtc gttgtggtta tgattggtaa cttaaaaggc acggaaattt tccatttaat taagaaggga gttctcatta cagccgtggt tgaggtgggg agaaagcaca tcatctggat gaatcactat ttggtctctt ttgtgattgt cacaactgct accttagcat atttcatctt ttatcacatt catagacttt gtttagcaag gattcagaac cggagatggc agcgattaac aacagatctt cagaacacat ttggacaact ccaacttcga gtagtaaaag agggggatga agaaataaat ccaaatgggg atagctgcgt aatttgcttt gaacgctata agcctaatga catagttcgt attctgactt gtaaacattt tttccacaag aattgcattg acccctggat tttaccccat gggacatgcc ccatttgcaa atgtgatatt cttaaagttt tggggattca agtggttgtt gaaaatggaa cagaaccttt gcaagttcta atgtcaaatg aactgcctga aaccttatca cctagtgaag aggagacaaa taatgaagtt tctcctgcag gaacctcaga taaagtaatc catgtggagg agaaccctac ttctcagaat aatgacatcc agcctcattc agtagtggaa gatgttcatc cttcaccttg a. It is sometimes possible for the material contained within the vial of "RNF133, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.