RNF13 cdna clone
RNF13 cDNA Clone
Gene Names
RNF13; RZF
Synonyms
RNF13; RNF13 cDNA Clone; RNF13 cdna clone
Sequence
atgctgctctccatagggatgctcatgctgtcagccacacaagtctacaccatcttgactgtccagctctttgcattcttaaacctactgcctgtagaagcagacattttagcatataactttgaaaatgcatctcagacatttgatgacctccctgcaagatttggttatagacttccagctgaaggtttaaagggttttttgattaactcaaaaccagagaatgcctgtgaacccatagtgcctccaccagtaaaagacaattcatctggcactttcatcgtgttaattagaagacttgattgtaattttgatataaaggttttaaatgcacagagagcaggatacaaggcagccatagttcacaatgttgattctgatgacctcattagcatgggatccaacgacattgaggtactaaagaaaattgacattccatctgtctttattggtgaatcatcagctaattctctgaaagatgaattcacatatgaaaaagggggccaccttatcttagttccagaatttagtcttcctttggaatactacctaattcccttccttatcatagtgggcatctgtctcatcttgatagtcattttcatgatcacaaaatttgtccaggatagacatagagctagaagaaacagacttcgtaaagatcaacttaagaaacttcctgtacataaattcaagaaaggagatgagtatgatgtatgtgccatttgtttggatgagtatgaagatggagacaaactcagaatccttccctgttcccatgcttatcattgcaagtgtgtagacccttggctaactaaaaccaaaaaaacctgtccagtgtgcaagcaaaaagttgttccttctcaaggcgattcagactctgacacagacagtagtcaagaagaaaatgaagtgacagaacatacccctttactgagacctttagcttctgtcagtgcccagtcatttggggctttatcggaatcccgctcacatcagaacatgacagaatcttcagactatgaggaagacgacaatgaagatactgacagtagtgatgcagaaaatgaaattaatgaacatgatgtcgtggtccagttgcagcctaatggtgaacgggattacaacatagcaaatactgtttga
Sequence Length
1146
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
29,713 Da
NCBI Official Full Name
Homo sapiens ring finger protein 13, mRNA
NCBI Official Synonym Full Names
ring finger protein 13
NCBI Official Symbol
RNF13
NCBI Official Synonym Symbols
RZF
NCBI Protein Information
E3 ubiquitin-protein ligase RNF13
UniProt Protein Name
E3 ubiquitin-protein ligase RNF13
Protein Family
UniProt Gene Name
RNF13
UniProt Synonym Gene Names
RZF
UniProt Entry Name
RNF13_HUMAN
NCBI Description
The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. The specific function of this gene has not yet been determined. Alternatively spliced transcript variants that encode the same protein have been reported. A pseudogene, which is also located on chromosome 3, has been defined for this gene. [provided by RefSeq, Jul 2008]
Uniprot Description
RNF13: E3 ubiquitin-protein ligase that may play a role in controlling cell proliferation.
Protein type: Ubiquitin ligase; EC 6.3.2.-; Ubiquitin conjugating system; EC 6.3.2.19; Ligase; Membrane protein, integral
Chromosomal Location of Human Ortholog: 3q25.1
Cellular Component: late endosome membrane; lysosomal membrane
Molecular Function: protein binding; ubiquitin-protein ligase activity
Biological Process: protein autoubiquitination
Research Articles on RNF13
Similar Products
Product Notes
The RNF13 rnf13 (Catalog #AAA1271412) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctct ccatagggat gctcatgctg tcagccacac aagtctacac catcttgact gtccagctct ttgcattctt aaacctactg cctgtagaag cagacatttt agcatataac tttgaaaatg catctcagac atttgatgac ctccctgcaa gatttggtta tagacttcca gctgaaggtt taaagggttt tttgattaac tcaaaaccag agaatgcctg tgaacccata gtgcctccac cagtaaaaga caattcatct ggcactttca tcgtgttaat tagaagactt gattgtaatt ttgatataaa ggttttaaat gcacagagag caggatacaa ggcagccata gttcacaatg ttgattctga tgacctcatt agcatgggat ccaacgacat tgaggtacta aagaaaattg acattccatc tgtctttatt ggtgaatcat cagctaattc tctgaaagat gaattcacat atgaaaaagg gggccacctt atcttagttc cagaatttag tcttcctttg gaatactacc taattccctt ccttatcata gtgggcatct gtctcatctt gatagtcatt ttcatgatca caaaatttgt ccaggataga catagagcta gaagaaacag acttcgtaaa gatcaactta agaaacttcc tgtacataaa ttcaagaaag gagatgagta tgatgtatgt gccatttgtt tggatgagta tgaagatgga gacaaactca gaatccttcc ctgttcccat gcttatcatt gcaagtgtgt agacccttgg ctaactaaaa ccaaaaaaac ctgtccagtg tgcaagcaaa aagttgttcc ttctcaaggc gattcagact ctgacacaga cagtagtcaa gaagaaaatg aagtgacaga acatacccct ttactgagac ctttagcttc tgtcagtgcc cagtcatttg gggctttatc ggaatcccgc tcacatcaga acatgacaga atcttcagac tatgaggaag acgacaatga agatactgac agtagtgatg cagaaaatga aattaatgaa catgatgtcg tggtccagtt gcagcctaat ggtgaacggg attacaacat agcaaatact gtttga. It is sometimes possible for the material contained within the vial of "RNF13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
