Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF126 cdna clone

RNF126 cDNA Clone

Synonyms
RNF126; RNF126 cDNA Clone; RNF126 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgaggcgtcgccgcatcccggacggtacttctgccactgctgctccgtggagatcgtcccgcgcctgccggattatatctgtccaagatgcgagtctggttttatcgaggagcttccggaagagaccaggagcacagaaaatggttctgccccctccacagctcccacagaccagagccggccaccgttggagcacgtggaccagcacctgttcacgctgccgcagggctacggacagtttgctttcggcatcttcgatgacagcttcgagatccccacgttccctcctggggcgcaggctgacgacggcagggaccctgagagccggcgggagagagaccatccgtcccggcaccggtacggcgcccgacagccccgcgcccgcctcaccacgcggcgggccaccggccggcacgaaggcgtccccacgctggaagggatcatccagcagctcgtcaacggcatcatcacgcccgccaccatccccagcctgggcccctggggagtcctgcactcaaaccctatggactacgcctggggggccaacggcctggatgccatcatcacacagctcctcaatcagtttgaaaacacaggccccccaccggcagataaagagaaaatccaggccctccccaccgtccccgtcactgaggagcacgtaggctccgggctcgagtgccctgtgtgcaaggacgactacgcgctgggtgagcgtgtgcggcagctgccctgcaaccacctgttccacgacggctgcatcgtgccctggctggagcagcacgacagctgccccgtctgccgaaaaagcctcacgggacagaacacggccacgaacccccctggcctcactggggtgagcttctcctcctcgtcgtcatcgtcctcctccagctcgcccagcaacgagaacgccacatggtcccctctggggcgtccccagcctccccgtcctctgtctaacctcaccctctaa
Sequence Length
981
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,861 Da
NCBI Official Full Name
Homo sapiens ring finger protein 126, mRNA
NCBI Official Synonym Full Names
ring finger protein 126
NCBI Official Symbol
RNF126
NCBI Protein Information
E3 ubiquitin-protein ligase RNF126
UniProt Protein Name
E3 ubiquitin-protein ligase RNF126
UniProt Gene Name
RNF126
UniProt Entry Name
RN126_HUMAN

NCBI Description

The protein encoded by this gene contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. [provided by RefSeq, Jul 2008]

Uniprot Description

RNF126: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.19; Ubiquitin ligase; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: cytoplasm; nucleus

Molecular Function: protein binding

Biological Process: negative regulation of epidermal growth factor receptor signaling pathway; proteasomal ubiquitin-dependent protein catabolic process; protein monoubiquitination; protein polyubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of cell proliferation; retrograde transport, endosome to Golgi; ubiquitin-dependent protein catabolic process via the multivesicular body pathway

Research Articles on RNF126

Similar Products

Product Notes

The RNF126 rnf126 (Catalog #AAA1269721) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgagg cgtcgccgca tcccggacgg tacttctgcc actgctgctc cgtggagatc gtcccgcgcc tgccggatta tatctgtcca agatgcgagt ctggttttat cgaggagctt ccggaagaga ccaggagcac agaaaatggt tctgccccct ccacagctcc cacagaccag agccggccac cgttggagca cgtggaccag cacctgttca cgctgccgca gggctacgga cagtttgctt tcggcatctt cgatgacagc ttcgagatcc ccacgttccc tcctggggcg caggctgacg acggcaggga ccctgagagc cggcgggaga gagaccatcc gtcccggcac cggtacggcg cccgacagcc ccgcgcccgc ctcaccacgc ggcgggccac cggccggcac gaaggcgtcc ccacgctgga agggatcatc cagcagctcg tcaacggcat catcacgccc gccaccatcc ccagcctggg cccctgggga gtcctgcact caaaccctat ggactacgcc tggggggcca acggcctgga tgccatcatc acacagctcc tcaatcagtt tgaaaacaca ggccccccac cggcagataa agagaaaatc caggccctcc ccaccgtccc cgtcactgag gagcacgtag gctccgggct cgagtgccct gtgtgcaagg acgactacgc gctgggtgag cgtgtgcggc agctgccctg caaccacctg ttccacgacg gctgcatcgt gccctggctg gagcagcacg acagctgccc cgtctgccga aaaagcctca cgggacagaa cacggccacg aacccccctg gcctcactgg ggtgagcttc tcctcctcgt cgtcatcgtc ctcctccagc tcgcccagca acgagaacgc cacatggtcc cctctggggc gtccccagcc tccccgtcct ctgtctaacc tcaccctcta a. It is sometimes possible for the material contained within the vial of "RNF126, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.