RNF113B cdna clone
RNF113B cDNA Clone
Gene Names
RNF113B; RNF161; ZNF183L1; bA10G5.1
Synonyms
RNF113B; RNF113B cDNA Clone; RNF113B cdna clone
Sequence
atggcagcgccaccttctccaggaaggacggccgaccaagcagaccaggtatgcaccttcctcttcaaaaagcctggacggaaaggggctgcaggcctcagaaagcgcccggcctgcgaccccgagcacggagagagcagcagcagcggggacgagggcgacacagtggctcagcccccgcgggtggcaccgaggccccggggcctccacagctggcagaaggcggctcacggcgacaggaggggcgaggaggcggcgcctgagagcctcgacgtggtgtacaggtccacccgctcggcgaagcctgtggggccggaggacatgggggccaccgctgacttcgagcaggacaccgagaaggagcaccatacgccgaccatcctcaagtgcagccagcgggtccaggaggcactgcggggtcgggagcacgaccacatctaccggggaatccacagctacctgaggtacctgaagcccaaggacacgtccatgggcaactcctcctcggggatggcgaggaagggccccatacgtgcgccagggcatctgcgcgccactgtgcgctgggattaccagcctgacatctgcaaggactacaaggagactggcttctgtggcttcggggacagctgcaaattcctccacgaccgttccgattacaagctcgggtgggagattgaacgggagcttgaagagggtcgctactgtatctgcgaggacgaaaaccatgaagtgggaagcgaggaagaggaaataccattcaggtgtttcatatgtcgccaggccttccaaaacccagtcgtcaccaagtgcaggcattatttctgcgagagctgcgcgctggagcacttccgggccaccccgcgctgctacatctgtgaccagccaaccggcggcatctttaaccccgccaaagaactgatggcgaaactgcaaaagcttcaggctgcagaaggaaaaaagagataa
Sequence Length
969
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
36,259 Da
NCBI Official Full Name
Homo sapiens ring finger protein 113B, mRNA
NCBI Official Synonym Full Names
ring finger protein 113B
NCBI Official Symbol
RNF113B
NCBI Official Synonym Symbols
RNF161; ZNF183L1; bA10G5.1
NCBI Protein Information
RING finger protein 113B
UniProt Protein Name
RING finger protein 113B
Protein Family
UniProt Gene Name
RNF113B
UniProt Synonym Gene Names
RNF161; ZNF183L1
UniProt Entry Name
R113B_HUMAN
Uniprot Description
RNF113B:
Protein type: Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: 13q32.2
Biological Process: nuclear mRNA cis splicing, via U2-type spliceosome
Similar Products
Product Notes
The RNF113B rnf113b (Catalog #AAA1269259) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcgc caccttctcc aggaaggacg gccgaccaag cagaccaggt atgcaccttc ctcttcaaaa agcctggacg gaaaggggct gcaggcctca gaaagcgccc ggcctgcgac cccgagcacg gagagagcag cagcagcggg gacgagggcg acacagtggc tcagcccccg cgggtggcac cgaggccccg gggcctccac agctggcaga aggcggctca cggcgacagg aggggcgagg aggcggcgcc tgagagcctc gacgtggtgt acaggtccac ccgctcggcg aagcctgtgg ggccggagga catgggggcc accgctgact tcgagcagga caccgagaag gagcaccata cgccgaccat cctcaagtgc agccagcggg tccaggaggc actgcggggt cgggagcacg accacatcta ccggggaatc cacagctacc tgaggtacct gaagcccaag gacacgtcca tgggcaactc ctcctcgggg atggcgagga agggccccat acgtgcgcca gggcatctgc gcgccactgt gcgctgggat taccagcctg acatctgcaa ggactacaag gagactggct tctgtggctt cggggacagc tgcaaattcc tccacgaccg ttccgattac aagctcgggt gggagattga acgggagctt gaagagggtc gctactgtat ctgcgaggac gaaaaccatg aagtgggaag cgaggaagag gaaataccat tcaggtgttt catatgtcgc caggccttcc aaaacccagt cgtcaccaag tgcaggcatt atttctgcga gagctgcgcg ctggagcact tccgggccac cccgcgctgc tacatctgtg accagccaac cggcggcatc tttaaccccg ccaaagaact gatggcgaaa ctgcaaaagc ttcaggctgc agaaggaaaa aagagataa. It is sometimes possible for the material contained within the vial of "RNF113B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
