Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF113A cdna clone

RNF113A cDNA Clone

Gene Names
RNF113A; TTD5; Cwc24; RNF113; ZNF183
Synonyms
RNF113A; RNF113A cDNA Clone; RNF113A cdna clone
Ordering
For Research Use Only!
Sequence
atggcagagcagctttctccaggaaaggcggtggatcaggtgtgcaccttccttttcaaaaagcctgggcggaaaggggctgctggacgcagaaagcgcccggcctgcgacccagagcccggagaaagcggcagcagtagcgacgaaggctgcactgtggttcgaccggaaaagaagcgggtgacccacaatccaatgatacagaagacccgtgacagtggtaaacagaaggcggcttacggcgacttgagcagcgaagaggaagaggaaaatgagcccgagagtctcggcgtggtttataaatccacccgttcggcgaaacccgtgggaccagaggatatgggagcgacagctgtctatgagctggacacagagaaagagcgcgatgcacaagccatctttgagcgcagccagaagatccaggaggagctgaggggcaaggaggatgacaagatctatcggggaatcaacaattatcagaaatacatgaagcccaaggatacgtctatgggcaatgcctcttccgggatggtgaggaagggccccatccgagcgcccgagcatctacgtgccaccgtgcgctgggattaccagcccgacatctgtaaggactacaaagagactggcttctgcggcttcggagacagctgcaaattcctccatgaccgttcagattacaagcatgggtggcagatcgaacgtgagcttgatgagggtcgctatggtgtctatgaggatgaaaactatgaagtgggaagcgatgatgaggaaataccattcaagtgtttcatctgtcgccagagcttccaaaacccagttgtcaccaagtgcaggcattatttctgcgagagctgtgcactgcagcatttccgcaccaccccgcgctgctatgtctgtgaccagcagaccaatggcgtcttcaatccagcgaaagaattgattgctaaactagagaagcatcgagctacaggagagggtggtgcttccgacttgccagaagaccccgatgaggatgcaattcccattacttag
Sequence Length
1032
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,787 Da
NCBI Official Full Name
Homo sapiens ring finger protein 113A, mRNA
NCBI Official Synonym Full Names
ring finger protein 113A
NCBI Official Symbol
RNF113A
NCBI Official Synonym Symbols
TTD5; Cwc24; RNF113; ZNF183
NCBI Protein Information
RING finger protein 113A
UniProt Protein Name
RING finger protein 113A
Protein Family
UniProt Gene Name
RNF113A
UniProt Synonym Gene Names
RNF113; ZNF183
UniProt Entry Name
R113A_HUMAN

NCBI Description

This intronless gene encodes a protein which contains a C3H1-type zinc finger domain and a C3HC4 Ring-type (Really Interesting New Gene-type) zinc finger domain. The Ring-type zinc finger domain is identified in various tumor suppressors, DNA repair genes and cytokine receptor-associated molecules, and is probably involved in mediating protein-protein interactions. [provided by RefSeq, May 2010]

Uniprot Description

ZNF183:

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: Xq24

Molecular Function: protein binding

Biological Process: nuclear mRNA cis splicing, via U2-type spliceosome

Disease: Trichothiodystrophy 5, Nonphotosensitive

Research Articles on RNF113A

Similar Products

Product Notes

The RNF113A rnf113a (Catalog #AAA1276078) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagagc agctttctcc aggaaaggcg gtggatcagg tgtgcacctt ccttttcaaa aagcctgggc ggaaaggggc tgctggacgc agaaagcgcc cggcctgcga cccagagccc ggagaaagcg gcagcagtag cgacgaaggc tgcactgtgg ttcgaccgga aaagaagcgg gtgacccaca atccaatgat acagaagacc cgtgacagtg gtaaacagaa ggcggcttac ggcgacttga gcagcgaaga ggaagaggaa aatgagcccg agagtctcgg cgtggtttat aaatccaccc gttcggcgaa acccgtggga ccagaggata tgggagcgac agctgtctat gagctggaca cagagaaaga gcgcgatgca caagccatct ttgagcgcag ccagaagatc caggaggagc tgaggggcaa ggaggatgac aagatctatc ggggaatcaa caattatcag aaatacatga agcccaagga tacgtctatg ggcaatgcct cttccgggat ggtgaggaag ggccccatcc gagcgcccga gcatctacgt gccaccgtgc gctgggatta ccagcccgac atctgtaagg actacaaaga gactggcttc tgcggcttcg gagacagctg caaattcctc catgaccgtt cagattacaa gcatgggtgg cagatcgaac gtgagcttga tgagggtcgc tatggtgtct atgaggatga aaactatgaa gtgggaagcg atgatgagga aataccattc aagtgtttca tctgtcgcca gagcttccaa aacccagttg tcaccaagtg caggcattat ttctgcgaga gctgtgcact gcagcatttc cgcaccaccc cgcgctgcta tgtctgtgac cagcagacca atggcgtctt caatccagcg aaagaattga ttgctaaact agagaagcat cgagctacag gagagggtgg tgcttccgac ttgccagaag accccgatga ggatgcaatt cccattactt ag. It is sometimes possible for the material contained within the vial of "RNF113A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.