RNF103 cdna clone
RNF103 cDNA Clone
Gene Names
RNF103; KF1; KF-1; HKF-1; ZFP103; ZFP-103
Synonyms
RNF103; RNF103 cDNA Clone; RNF103 cdna clone
Sequence
atgtggctgaagctttttttcttgctcctctatttcctggtcctgttcgtcctggccaggttttttgaggccattgtgtggtatgaaactggcatctttgccacccagctggtggatccggtggcgctgagcttcaagaagctgaagaccattttggagtgccgggggttgggctactcagggttgcccgagaagaaggatgtccgggagctggtggaaaagtcaggtgacttgatggagggtgagctctattctgctctcaaggaagaagaagcatccgaatcggtttctagtaccaatttcagtggtgaaatgcacttctatgagcttgtggaagacacaaaagatggcatctggctggttcaggtcatagcaaatgacagaagtcccttggtgggcaaaattcactgggagaaaatggttaaaaaggtgtcaagatttggaatacgtacaggcacatttaactgttccagtgatcccagatattgcaggagaagaggctgggtccgatccacactcattatgtctgttccacaaacaagtacttcaaaagggaaagtcatgcttaaagaatacagtggacgcaagattgaagtagagcacatttttaaatggataactgctcatgcagcttctcggatcaaaaccatttataatgctgaacacttgaaagaagaatggaataaaagtgatcagtattggttaaaaatatacctatttgcaaaccttgaccagcccccagctttcttccctgcactaagtataaagtttactggaagagttgagtttatttttgttaatgtagaaaattgggacaacaagagttatatgacagatattggcatatataatatgccatcatacatacttagaactcctgaaggaatttacaggtatggaaaccacacaggcgaatttatatcccttcaggccatggattcatttttgcgctcattacaacccgaggtaaatgatctgtttgttttgagcttggttctagttaatcttatggcttggatggacttatttattacacaaggagctaccataaagcgatttgtggttctcataagcactttagggacatataattctctattaattatttcctggctacctgtgttgggctttttacagctaccttacttagatagcttttatgaatatagcttaaaattgttgagatattccaatacaaccacactggcttcatgggtaagggcagactggatgttttactcttcacacccagccctgtttctcagtacataccttggtcatggtttactaattgattactttgagaagaagagaaggcgcaacaacaacaatgatgaagtcaatgccaataacttagaatggttatcaagtctgtgggactggtacaccagctacctcttccacccgattgcttcttttcagaactttcctgtagaatctgattgggacgaagaccctgacttattcttggagcgcttagctttccctgacctttggcttcaccatctgataccaactgattatattaaaaacttaccaatgtggcgatttaaatgtcttggagtccagtctgaagaggaaatgtcggaggggtctcaagatactgaaaatgactcggaaagtgagaacacagacactttgagtagtgagaaggaagtatttgaagataagcaaagcgtacttcacaattctccaggaacagcaagtcactgtgatgctgaggcttgttcatgtgccaataaatattgtcagaccagcccatgtgaaaggaaggggaggtcatatggatcatataacactaatgaagatatggaacctgattggttaacttggcctgctgatatgctgcactgtactgaatgtgttgtttgcctagagaattttgaaaatggatgtttgctaatggggttgccttgtggtcatgtgtttcatcagaattgcattgtgatgtggttggctgggggccgacattgttgccctgtttgccggtggccttcttataaaaaaaagcagccatatgcacaacaccagcccttgtcaaatgatgtcccatcttaa
Sequence Length
2058
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
79,405 Da
NCBI Official Full Name
Homo sapiens ring finger protein 103, mRNA
NCBI Official Synonym Full Names
ring finger protein 103
NCBI Official Symbol
RNF103
NCBI Official Synonym Symbols
KF1; KF-1; HKF-1; ZFP103; ZFP-103
NCBI Protein Information
E3 ubiquitin-protein ligase RNF103
UniProt Protein Name
E3 ubiquitin-protein ligase RNF103
Protein Family
UniProt Gene Name
RNF103
UniProt Synonym Gene Names
ZFP103; hKF-1; Zfp-103
UniProt Entry Name
RN103_HUMAN
NCBI Description
The protein encoded by this gene contains a RING-H2 finger, a motif known to be involved in protein-protein and protein-DNA interactions. This gene is highly expressed in normal cerebellum, but not in the cerebral cortex. The expression of the rat counterpart in the frontal cortex and hippocampus was shown to be induced by elctroconvulsive treatment (ECT) as well as chronic antidepressant treatment, suggesting that this gene may be a molecular target for ECT and antidepressants. The protein is a ubiquitin ligase that functions in the endoplasmic reticulum-associated degradation pathway. Alternative splicing of this gene results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream CHMP3 (charged multivesicular body protein 3) gene. [provided by RefSeq, Oct 2011]
Uniprot Description
RNF103: Acts as an E2-dependent E3 ubiquitin-protein ligase, probably involved in the ER-associated protein degradation pathway.
Protein type: Ubiquitin conjugating system; Membrane protein, multi-pass; EC 6.3.2.19; EC 6.3.2.-; Membrane protein, integral; Ubiquitin ligase
Chromosomal Location of Human Ortholog: 2p11.2
Cellular Component: endoplasmic reticulum
Molecular Function: protein binding; ubiquitin-protein ligase activity
Biological Process: central nervous system development; ER-associated protein catabolic process; protein ubiquitination
Research Articles on RNF103
Similar Products
Product Notes
The RNF103 rnf103 (Catalog #AAA1267805) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggctga agcttttttt cttgctcctc tatttcctgg tcctgttcgt cctggccagg ttttttgagg ccattgtgtg gtatgaaact ggcatctttg ccacccagct ggtggatccg gtggcgctga gcttcaagaa gctgaagacc attttggagt gccgggggtt gggctactca gggttgcccg agaagaagga tgtccgggag ctggtggaaa agtcaggtga cttgatggag ggtgagctct attctgctct caaggaagaa gaagcatccg aatcggtttc tagtaccaat ttcagtggtg aaatgcactt ctatgagctt gtggaagaca caaaagatgg catctggctg gttcaggtca tagcaaatga cagaagtccc ttggtgggca aaattcactg ggagaaaatg gttaaaaagg tgtcaagatt tggaatacgt acaggcacat ttaactgttc cagtgatccc agatattgca ggagaagagg ctgggtccga tccacactca ttatgtctgt tccacaaaca agtacttcaa aagggaaagt catgcttaaa gaatacagtg gacgcaagat tgaagtagag cacattttta aatggataac tgctcatgca gcttctcgga tcaaaaccat ttataatgct gaacacttga aagaagaatg gaataaaagt gatcagtatt ggttaaaaat atacctattt gcaaaccttg accagccccc agctttcttc cctgcactaa gtataaagtt tactggaaga gttgagttta tttttgttaa tgtagaaaat tgggacaaca agagttatat gacagatatt ggcatatata atatgccatc atacatactt agaactcctg aaggaattta caggtatgga aaccacacag gcgaatttat atcccttcag gccatggatt catttttgcg ctcattacaa cccgaggtaa atgatctgtt tgttttgagc ttggttctag ttaatcttat ggcttggatg gacttattta ttacacaagg agctaccata aagcgatttg tggttctcat aagcacttta gggacatata attctctatt aattatttcc tggctacctg tgttgggctt tttacagcta ccttacttag atagctttta tgaatatagc ttaaaattgt tgagatattc caatacaacc acactggctt catgggtaag ggcagactgg atgttttact cttcacaccc agccctgttt ctcagtacat accttggtca tggtttacta attgattact ttgagaagaa gagaaggcgc aacaacaaca atgatgaagt caatgccaat aacttagaat ggttatcaag tctgtgggac tggtacacca gctacctctt ccacccgatt gcttcttttc agaactttcc tgtagaatct gattgggacg aagaccctga cttattcttg gagcgcttag ctttccctga cctttggctt caccatctga taccaactga ttatattaaa aacttaccaa tgtggcgatt taaatgtctt ggagtccagt ctgaagagga aatgtcggag gggtctcaag atactgaaaa tgactcggaa agtgagaaca cagacacttt gagtagtgag aaggaagtat ttgaagataa gcaaagcgta cttcacaatt ctccaggaac agcaagtcac tgtgatgctg aggcttgttc atgtgccaat aaatattgtc agaccagccc atgtgaaagg aaggggaggt catatggatc atataacact aatgaagata tggaacctga ttggttaact tggcctgctg atatgctgca ctgtactgaa tgtgttgttt gcctagagaa ttttgaaaat ggatgtttgc taatggggtt gccttgtggt catgtgtttc atcagaattg cattgtgatg tggttggctg ggggccgaca ttgttgccct gtttgccggt ggccttctta taaaaaaaag cagccatatg cacaacacca gcccttgtca aatgatgtcc catcttaa. It is sometimes possible for the material contained within the vial of "RNF103, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
