RIN1 cdna clone
RIN1 cDNA Clone
Synonyms
RIN1; RIN1 cDNA Clone; RIN1 cdna clone
Sequence
atggaaagccctggagagtcaggcgcgggctctcctggagcccccagcccgtccagcttcactactgggcacctggcgagagaaaagccagcccaggacccactgtatgacgtgcccaatgccagcggcgggcaggcaggcgggccgcagcggccggggcgcgttgtgagcctgcgggagcgcctgctgctcacccggcccgtgtggctgcagctgcaagccaacgcagcggccgcactgcacatgctgaggaccgagcccccggggacgttcctcgtgcggaaatctaacacccgccagtgccaggccctgtgcatgcggttgcctgaagccagtggcccctccttcgtctccagccactacatcctggagagccctggcggcgtctccttggagggctcggagctcatgttcccagacctagtccagctcatctgtgcctactgccacacccgggacatccttctcctcccgctgcagctccccagagccatccaccacgcagccactcacaaagagctggaggccatctcccatctgggcattgagttctggagctcctccctcaacatcaaggctcagcggggcccggctggaggcccagtgttgccccagctgaaggcccggtcccctcaagagctggaccagggcaccggagccgccttgtgcttcttcaaccccctgttcccgggggacctagggcccaccaagcgggagaaattcaagagaagcttcaaagtgcgcgtgtccacagagacctccagccccctgtctccacctgccgtgccacctccccccgtccccgtgctgccaggggcagtccccagccagacagagcggctgcccccttgccagctgctacggagggagagctcagtggggtaccgcgtgccagcaggcagtggccctagccttccgcctatgccctccctccaagaggtggactgcggctcccccagcagctccgaggaggagggggtgccagggtcccgggggagcccagcgacctcaccccacctgggccgccgacgacctctgcttcggtccatgagcgccgccttctgctccctactggcaccggagcggcaggtgggccgggctgcggcagcactgatgcaggaccgacacacagccgcgggccagctggtgcaggacctactgacccaggtgcgggctgggcccgagccccaggagctgcagggcatccgtcaggcgctgagccgggcccgggccatgctgagtgcggagctgggccctgagaagctgctgtcgcctaagaggctggaacatgtcctggagaagtcattgcattgctctgtgctcaagcctctccggcccatcctggcagcccgcctgcggcgccggcttgccgcagacggctccctgggccgcctagctgagggcctccgcctggcccgggcccagggccccggagccttcgggtcccacctgagcctgccctccccagtagagttggagcaagtgcgccagaagctgctgcagctgctccgcacctactcacccagcgcccaggtcaagcggctcctgcaggcctgcaagctgctctacatggccctgaggacccaggaaggggagggcgcgggtgccgacgagttcctgcctctgctgagcctcgtcttggcccactgtgaccttcctgagctgctgctggaggccgagtacatgtcggagctgctggagcccagcctgcttactggagagggtggctactacctgaccagcctctctgccagcctggccctgctgagtggcctgggtcaggcccacaccctcccactgagccccgtgcaggagctacggcgctccctcagcctctgggagcagcgccgcctgcctgccacccactgcttccagcacctcctccgagtagcctatcaggatcccagcagtggctgcacctccaagaccctggccgtgcccccagaggcctcgattgccaccctgaaccagctctgtgccaccaagttccgagtgacccagcccaacacttttggcctcttcctgtacaaggagcagggctaccaccgcctgccccctggggccctggcccacaggctgcccaccactggctacctcgtctaccgccgggcagagtggcctgagacccagggggctgtgacagaggaggagggcagtgggcagtcagaggcaagaagcagaggggaggagcaagggtgccagggagatggggatgctggggtcaaagccagccccagggacattcgggaacagtctgagacaactgctgaagggggccagggtcaagcccaggaaggccctgctcagccaggggaaccagaggcagagggaagccgggcagcagaggagtag
Sequence Length
2352
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
77,500 Da
NCBI Official Full Name
Homo sapiens Ras and Rab interactor 1, mRNA
NCBI Official Synonym Full Names
Ras and Rab interactor 1
NCBI Official Symbol
RIN1
NCBI Protein Information
ras and Rab interactor 1
UniProt Protein Name
Ras and Rab interactor 1
Protein Family
UniProt Gene Name
RIN1
UniProt Entry Name
RIN1_HUMAN
Uniprot Description
Rin1: Ras effector protein, which may serve as an inhibitory modulator of neuronal plasticity in aversive memory formation. Can affect Ras signaling at different levels. First, by competing with RAF1 protein for binding to activated Ras. Second, by enhancing signaling from ABL1 and ABL2, which regulate cytoskeletal remodeling. Third, by activating RAB5A, possibly by functioning as a guanine nucleotide exchange factor (GEF) for RAB5A, by exchanging bound GDP for free GTP, and facilitating Ras-activated receptor endocytosis. Interacts with the GTP-bound form of Ras proteins (NRAS, HRAS and KRAS). This interaction prevents the association between RAF1 and Ras. Interacts with 14-3-3 proteins YWHAB, YWHAE and YWHAZ when phosphorylated on Ser-351. Interacts with the SH3 domain of ABL1 and ABL2. Interacts with RAB5A. The interaction with Ras is probably regulated and antagonized by the interaction with 14-3-3 proteins. The interaction with 14-3-3 proteins is regulated by phosphorylation on Ser-351. Expressed in all tissues examined with high levels in brain, placenta and pancreas. Belongs to the RIN (Ras interaction/interference) family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: GEFs, Rab; GEFs
Chromosomal Location of Human Ortholog: 11q13.2
Cellular Component: cytoplasm; plasma membrane
Molecular Function: protein binding
Research Articles on RIN1
Similar Products
Product Notes
The RIN1 rin1 (Catalog #AAA1276631) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaagcc ctggagagtc aggcgcgggc tctcctggag cccccagccc gtccagcttc actactgggc acctggcgag agaaaagcca gcccaggacc cactgtatga cgtgcccaat gccagcggcg ggcaggcagg cgggccgcag cggccggggc gcgttgtgag cctgcgggag cgcctgctgc tcacccggcc cgtgtggctg cagctgcaag ccaacgcagc ggccgcactg cacatgctga ggaccgagcc cccggggacg ttcctcgtgc ggaaatctaa cacccgccag tgccaggccc tgtgcatgcg gttgcctgaa gccagtggcc cctccttcgt ctccagccac tacatcctgg agagccctgg cggcgtctcc ttggagggct cggagctcat gttcccagac ctagtccagc tcatctgtgc ctactgccac acccgggaca tccttctcct cccgctgcag ctccccagag ccatccacca cgcagccact cacaaagagc tggaggccat ctcccatctg ggcattgagt tctggagctc ctccctcaac atcaaggctc agcggggccc ggctggaggc ccagtgttgc cccagctgaa ggcccggtcc cctcaagagc tggaccaggg caccggagcc gccttgtgct tcttcaaccc cctgttcccg ggggacctag ggcccaccaa gcgggagaaa ttcaagagaa gcttcaaagt gcgcgtgtcc acagagacct ccagccccct gtctccacct gccgtgccac ctccccccgt ccccgtgctg ccaggggcag tccccagcca gacagagcgg ctgccccctt gccagctgct acggagggag agctcagtgg ggtaccgcgt gccagcaggc agtggcccta gccttccgcc tatgccctcc ctccaagagg tggactgcgg ctcccccagc agctccgagg aggagggggt gccagggtcc cgggggagcc cagcgacctc accccacctg ggccgccgac gacctctgct tcggtccatg agcgccgcct tctgctccct actggcaccg gagcggcagg tgggccgggc tgcggcagca ctgatgcagg accgacacac agccgcgggc cagctggtgc aggacctact gacccaggtg cgggctgggc ccgagcccca ggagctgcag ggcatccgtc aggcgctgag ccgggcccgg gccatgctga gtgcggagct gggccctgag aagctgctgt cgcctaagag gctggaacat gtcctggaga agtcattgca ttgctctgtg ctcaagcctc tccggcccat cctggcagcc cgcctgcggc gccggcttgc cgcagacggc tccctgggcc gcctagctga gggcctccgc ctggcccggg cccagggccc cggagccttc gggtcccacc tgagcctgcc ctccccagta gagttggagc aagtgcgcca gaagctgctg cagctgctcc gcacctactc acccagcgcc caggtcaagc ggctcctgca ggcctgcaag ctgctctaca tggccctgag gacccaggaa ggggagggcg cgggtgccga cgagttcctg cctctgctga gcctcgtctt ggcccactgt gaccttcctg agctgctgct ggaggccgag tacatgtcgg agctgctgga gcccagcctg cttactggag agggtggcta ctacctgacc agcctctctg ccagcctggc cctgctgagt ggcctgggtc aggcccacac cctcccactg agccccgtgc aggagctacg gcgctccctc agcctctggg agcagcgccg cctgcctgcc acccactgct tccagcacct cctccgagta gcctatcagg atcccagcag tggctgcacc tccaagaccc tggccgtgcc cccagaggcc tcgattgcca ccctgaacca gctctgtgcc accaagttcc gagtgaccca gcccaacact tttggcctct tcctgtacaa ggagcagggc taccaccgcc tgccccctgg ggccctggcc cacaggctgc ccaccactgg ctacctcgtc taccgccggg cagagtggcc tgagacccag ggggctgtga cagaggagga gggcagtggg cagtcagagg caagaagcag aggggaggag caagggtgcc agggagatgg ggatgctggg gtcaaagcca gccccaggga cattcgggaa cagtctgaga caactgctga agggggccag ggtcaagccc aggaaggccc tgctcagcca ggggaaccag aggcagaggg aagccgggca gcagaggagt ag. It is sometimes possible for the material contained within the vial of "RIN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
