RHPN2 cdna clone
RHPN2 cDNA Clone
Gene Names
RHPN2; RHOBP; P76RBE
Synonyms
RHPN2; RHPN2 cDNA Clone; RHPN2 cdna clone
Sequence
atgaccgacgcgctgttgcccgcggccccccagccgctggagaagaagaacgacggctactttcggaagggctgtaatccccttgcacaaaccggccggagtaaattgcagaatcaaagagctgctttgaatcagcagatcctgaaagccgtgcggatgaggaccggagcggaaaaccttctgaaagtggccacaaactcaaaggtgcgggagcaagtgcggctggagctgagcttcgtcaactcagacctgcagatgctcaaggaagagctggaggggctgaacatctcggtgggcgtctatcagaacacagaggaggcatttacgattcccctgattcctcttggcctgaaggaaacgaaagacgtcgactttgcagtcgtcctcaaggattttatcctggaacattacagtgaagatggctatttatatgaagatgaaattgcagatcttatggatctgagacaagcttgtcggacgcctagccgggatgaggccggggtggaactgctgatgacatacttcatccagctgggctttgtcgagagtcgattcttcccgcccacacggcagatgggactcctgttcacctggtatgactctctcaccggggttccggtcagccagcagaacctgctgctggagaaggccagtgtcctgttcaacactggggccctctacacccagattgggacccggtgtgatcggcagacgcaggctgggctggagagtgccatagatgcctttcagagagccgcaggggttttaaattacctgaaagacacatttacccatactccaagttacgacatgagccctgccatgctcagcgtgctcgtcaaaatgatgcttgcacaagcccaagaaagcgtgtttgagaaaatcagccttcctgggatccggaatgaattcttcatgctggtgaaggtggctcaggaggctgctaaggtgggagaggtctaccaacagctacacgcagccatgagccaggcgccggtgaaagagaacatcccctactcctgggccagcttagcctgcgtgaaggcccaccactacgcggccctggcccactacttcactgccatcctcctcatcgaccaccaggtgaagccaggcacggatctggaccaccaggagaagtgcctgtcccagctctacgaccacatgccagaggggctgacacccttggccacactgaagaatgatcagcagcgccgacagctggggaagtcccacttgcgcagagccatggctcatcacgaggagtcggtgcgggaggccagcctctgcaagaagctgcggagcattgaggtgctacagaaggtgctgtgtgccgcacaggaacgctcccggctcacgtacgcccagcaccaggaggaggatgacctgctgaacctgatcgacgcccccagtgttgttgctaaaactgagcaagaggttgacattatattgccccagttctccaagctgacagtcacggacttcttccagaagctgggccccttatctgtgttttcggctaacaagcggtggacgcctcctcgaagcatccgcttcactgcagaagaaggggacttggggttcaccttgagagggaacgcccccgttcaggttcacttcctggatccttactgctctgcctcggtggcaggagcccgggaaggagattatattgtctccattcagcttgtggattgtaagtggctgacgctgagtgaggttatgaagctgctgaagagctttggcgaggacgagatcgagatgaaagtcgtgagcctcctggactccacatcatccatgcataataagagtgccacatactccgtgggaatgcagaaaacgtactccatgatctgcttagccattgatgatgacgacaaaactgataaaaccaagaaaatctccaagaagctttccttcctgagttggggcaccaacaagaacagacagaagtcagccagcaccttgtgcctcccatcggtcggggctgcacggcctcaggtcaagaagaagctgccctcccctttcagccttctcaactcagacagttcttggtactaa
Sequence Length
2061
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
59,998 Da
NCBI Official Full Name
Homo sapiens rhophilin, Rho GTPase binding protein 2, mRNA
NCBI Official Synonym Full Names
rhophilin Rho GTPase binding protein 2
NCBI Official Symbol
RHPN2
NCBI Official Synonym Symbols
RHOBP; P76RBE
NCBI Protein Information
rhophilin-2
UniProt Protein Name
Rhophilin-2
Protein Family
UniProt Gene Name
RHPN2
UniProt Entry Name
RHPN2_HUMAN
NCBI Description
This gene encodes a member of the rhophilin family of Ras-homologous (Rho)-GTPase binding proteins. The encoded protein binds both GTP- and GDP-bound RhoA and GTP-bound RhoB and may be involved in the organization of the actin cytoskeleton. [provided by RefSeq, Apr 2009]
Uniprot Description
RHPN2: Binds specifically to GTP-Rho. May function in a Rho pathway to limit stress fiber formation and/or increase the turnover of F-actin structures in the absence of high levels of RhoA activity. Belongs to the RHPN family.
Protein type: Vesicle
Chromosomal Location of Human Ortholog: 19q13.11
Cellular Component: cytoplasm; cytosol; intracellular membrane-bound organelle; nucleoplasm
Research Articles on RHPN2
Similar Products
Product Notes
The RHPN2 rhpn2 (Catalog #AAA1271904) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccgacg cgctgttgcc cgcggccccc cagccgctgg agaagaagaa cgacggctac tttcggaagg gctgtaatcc ccttgcacaa accggccgga gtaaattgca gaatcaaaga gctgctttga atcagcagat cctgaaagcc gtgcggatga ggaccggagc ggaaaacctt ctgaaagtgg ccacaaactc aaaggtgcgg gagcaagtgc ggctggagct gagcttcgtc aactcagacc tgcagatgct caaggaagag ctggaggggc tgaacatctc ggtgggcgtc tatcagaaca cagaggaggc atttacgatt cccctgattc ctcttggcct gaaggaaacg aaagacgtcg actttgcagt cgtcctcaag gattttatcc tggaacatta cagtgaagat ggctatttat atgaagatga aattgcagat cttatggatc tgagacaagc ttgtcggacg cctagccggg atgaggccgg ggtggaactg ctgatgacat acttcatcca gctgggcttt gtcgagagtc gattcttccc gcccacacgg cagatgggac tcctgttcac ctggtatgac tctctcaccg gggttccggt cagccagcag aacctgctgc tggagaaggc cagtgtcctg ttcaacactg gggccctcta cacccagatt gggacccggt gtgatcggca gacgcaggct gggctggaga gtgccataga tgcctttcag agagccgcag gggttttaaa ttacctgaaa gacacattta cccatactcc aagttacgac atgagccctg ccatgctcag cgtgctcgtc aaaatgatgc ttgcacaagc ccaagaaagc gtgtttgaga aaatcagcct tcctgggatc cggaatgaat tcttcatgct ggtgaaggtg gctcaggagg ctgctaaggt gggagaggtc taccaacagc tacacgcagc catgagccag gcgccggtga aagagaacat cccctactcc tgggccagct tagcctgcgt gaaggcccac cactacgcgg ccctggccca ctacttcact gccatcctcc tcatcgacca ccaggtgaag ccaggcacgg atctggacca ccaggagaag tgcctgtccc agctctacga ccacatgcca gaggggctga cacccttggc cacactgaag aatgatcagc agcgccgaca gctggggaag tcccacttgc gcagagccat ggctcatcac gaggagtcgg tgcgggaggc cagcctctgc aagaagctgc ggagcattga ggtgctacag aaggtgctgt gtgccgcaca ggaacgctcc cggctcacgt acgcccagca ccaggaggag gatgacctgc tgaacctgat cgacgccccc agtgttgttg ctaaaactga gcaagaggtt gacattatat tgccccagtt ctccaagctg acagtcacgg acttcttcca gaagctgggc cccttatctg tgttttcggc taacaagcgg tggacgcctc ctcgaagcat ccgcttcact gcagaagaag gggacttggg gttcaccttg agagggaacg cccccgttca ggttcacttc ctggatcctt actgctctgc ctcggtggca ggagcccggg aaggagatta tattgtctcc attcagcttg tggattgtaa gtggctgacg ctgagtgagg ttatgaagct gctgaagagc tttggcgagg acgagatcga gatgaaagtc gtgagcctcc tggactccac atcatccatg cataataaga gtgccacata ctccgtggga atgcagaaaa cgtactccat gatctgctta gccattgatg atgacgacaa aactgataaa accaagaaaa tctccaagaa gctttccttc ctgagttggg gcaccaacaa gaacagacag aagtcagcca gcaccttgtg cctcccatcg gtcggggctg cacggcctca ggtcaagaag aagctgccct cccctttcag ccttctcaac tcagacagtt cttggtacta a. It is sometimes possible for the material contained within the vial of "RHPN2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
