RHOXF2 cdna clone
RHOXF2 cDNA Clone
Gene Names
RHOXF2; THG1; CT107; PEPP2; PEPP-2
Synonyms
RHOXF2; RHOXF2 cDNA Clone; RHOXF2 cdna clone
Sequence
atggagcctccggaccagtgtagccagtatatgaccagcttgctcagccctgcagtcgacgacgagaaagaactacaggatatgaatgctatggtgctgtcgcttactgaagaggtcaaagaggaggaagaggatgcacagcctgagcctgagcaaggcacagcagcaggagaaaagttaaagtcggcaggagcccaaggcggagaagaaaaagatggcggcggagaagaaaaagatggcggcggcgccggagttcctggccacctatgggaaggagacctcgagggcaccagcggcagcgatggcaacgttgaggacagcgaccagagcgagaaggaacctgggcagcagtattcgcgcccacagggcgccgtcggggggctggagcctggcaacgcgcagcagcccaacgtccacgccttcaccccattgcagctgcaggagctggagcgcattttccaacgcgagcagttccccagtgagttcctgcgaaggaggctggcaagaagcatgaatgtgactgaactcgcagtgcagatttggtttgagaatagaagagccaaatggaggagacatcagagggcattaatggcaagaaacatgctgcccttcatggcagtgggccagcctgtcatggtaaccgcagctgaggccataacggcacccttgttcatcagcgggatgagagatgattacttctgggaccacagccattccagcagcctgtgtttccccatgccaccctttcctcctccgtccttgccccttccactcatgcttcttccacctatgccacccgctggccaggctgaatttggcccattcccttttgttatcgtgccttctttcacattccccaatgtctaa
Sequence Length
867
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,692 Da
NCBI Official Full Name
Homo sapiens Rhox homeobox family, member 2, mRNA
NCBI Official Synonym Full Names
Rhox homeobox family member 2
NCBI Official Symbol
RHOXF2
NCBI Official Synonym Symbols
THG1; CT107; PEPP2; PEPP-2
NCBI Protein Information
rhox homeobox family member 2
UniProt Protein Name
Rhox homeobox family member 2
Protein Family
UniProt Gene Name
RHOXF2
UniProt Synonym Gene Names
PEPP2; THG1
UniProt Entry Name
RHXF2_HUMAN
NCBI Description
This gene, which encodes a transcriptional repressor, is one of two paralogous X-linked homeobox-containing genes and is highly expressed in a variety of cancers. In addition, the encoded protein associates with the cell membrane and with microtubules, and is concentrated at the leading edge of migratory cells. [provided by RefSeq, Dec 2015]
Uniprot Description
RHOXF2: Belongs to the paired-like homeobox family. PEPP subfamily.
Protein type: Transcription factor; DNA-binding; Cancer Testis Antigen (CTA)
Chromosomal Location of Human Ortholog: Xq24
Molecular Function: protein binding
Research Articles on RHOXF2
Similar Products
Product Notes
The RHOXF2 rhoxf2 (Catalog #AAA1272396) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcctc cggaccagtg tagccagtat atgaccagct tgctcagccc tgcagtcgac gacgagaaag aactacagga tatgaatgct atggtgctgt cgcttactga agaggtcaaa gaggaggaag aggatgcaca gcctgagcct gagcaaggca cagcagcagg agaaaagtta aagtcggcag gagcccaagg cggagaagaa aaagatggcg gcggagaaga aaaagatggc ggcggcgccg gagttcctgg ccacctatgg gaaggagacc tcgagggcac cagcggcagc gatggcaacg ttgaggacag cgaccagagc gagaaggaac ctgggcagca gtattcgcgc ccacagggcg ccgtcggggg gctggagcct ggcaacgcgc agcagcccaa cgtccacgcc ttcaccccat tgcagctgca ggagctggag cgcattttcc aacgcgagca gttccccagt gagttcctgc gaaggaggct ggcaagaagc atgaatgtga ctgaactcgc agtgcagatt tggtttgaga atagaagagc caaatggagg agacatcaga gggcattaat ggcaagaaac atgctgccct tcatggcagt gggccagcct gtcatggtaa ccgcagctga ggccataacg gcacccttgt tcatcagcgg gatgagagat gattacttct gggaccacag ccattccagc agcctgtgtt tccccatgcc accctttcct cctccgtcct tgccccttcc actcatgctt cttccaccta tgccacccgc tggccaggct gaatttggcc cattcccttt tgttatcgtg ccttctttca cattccccaa tgtctaa. It is sometimes possible for the material contained within the vial of "RHOXF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
