RHOV cdna clone
RHOV cDNA Clone
Gene Names
RHOV; CHP; ARHV; WRCH2
Synonyms
RHOV; RHOV cDNA Clone; RHOV cdna clone
Sequence
ATGCCGCCGCGGGAGCTGAGCGAGGCCGAGCCGCCCCCGCTCCGGGCCCCGACCCCTCCCCCGCGGCGGCGTAGCGCGCCCCCAGAGCTGGGCATCAAGTGCGTGCTGGTGGGCGACGGCGCCGTGGGCAAGAGCAGCCTCATCGTCAGCTACACCTGCAATGGGTACCCCGCGCGCTACCGGCCCACTGCGCTGGACACCTTCTCTGTGCAAGTCCTGGTGGATGGAGCTCCGGTGCGCATTGAGCTCTGGGACACAGCGGGACAGGAGGATTTTGACCGACTTCGTTCCCTTTGCTACCCGGATACCGATGTCTTCCTGGCGTGCTTCAGCGTGGTGCAGCCCAGCTCCTTTCAAAACATCACAGAGAAATGGCTGCCCGAGATCCGCACGCACAACCCCCAGGCGCCTGTGCTGCTGGTGGGCACCCAGGCCGACCTGAGGGACGATGTCAACGTACTAATTCAGCTGGACCAGGGGGGCCGGGAGGGCCCCGTGCCCCAACCCCAGGCTCAGGGTCTGGCCGAGAAGATCCGAGCCTGCTGCTACCTTGAGTGCTCAGCCTTGACGCAGAAGAACTTGAAGGAAGTATTTGACTCGGCTATTCTCAGTGCCATTGAGCACAAAGCCCGGCTGGAGAAGAAACTGAATGCCAAAGGTGTGCGCACCCTCTCCCGCTGCCGCTGGAAGAAGTTCTTCTGCTTCGTTTGA
Sequence Length
711
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
26,217 Da
NCBI Official Full Name
Homo sapiens ras homolog gene family, member V, mRNA
NCBI Official Synonym Full Names
ras homolog family member V
NCBI Official Symbol
RHOV
NCBI Official Synonym Symbols
CHP; ARHV; WRCH2
NCBI Protein Information
rho-related GTP-binding protein RhoV
UniProt Protein Name
Rho-related GTP-binding protein RhoV
Protein Family
UniProt Gene Name
RHOV
UniProt Synonym Gene Names
WRCH-2
UniProt Entry Name
RHOV_HUMAN
Uniprot Description
RHOV: Plays a role in the control of the actin cytoskeleton via activation of the JNK pathway. Belongs to the small GTPase superfamily. Rho family.
Protein type: Motility/polarity/chemotaxis; G protein, monomeric; G protein, monomeric, Rho; G protein
Chromosomal Location of Human Ortholog: 15q13.3
Cellular Component: cytosol; plasma membrane
Molecular Function: protein binding
Biological Process: regulation of small GTPase mediated signal transduction
Research Articles on RHOV
Similar Products
Product Notes
The RHOV rhov (Catalog #AAA1271707) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGCCGCCGC GGGAGCTGAG CGAGGCCGAG CCGCCCCCGC TCCGGGCCCC GACCCCTCCC CCGCGGCGGC GTAGCGCGCC CCCAGAGCTG GGCATCAAGT GCGTGCTGGT GGGCGACGGC GCCGTGGGCA AGAGCAGCCT CATCGTCAGC TACACCTGCA ATGGGTACCC CGCGCGCTAC CGGCCCACTG CGCTGGACAC CTTCTCTGTG CAAGTCCTGG TGGATGGAGC TCCGGTGCGC ATTGAGCTCT GGGACACAGC GGGACAGGAG GATTTTGACC GACTTCGTTC CCTTTGCTAC CCGGATACCG ATGTCTTCCT GGCGTGCTTC AGCGTGGTGC AGCCCAGCTC CTTTCAAAAC ATCACAGAGA AATGGCTGCC CGAGATCCGC ACGCACAACC CCCAGGCGCC TGTGCTGCTG GTGGGCACCC AGGCCGACCT GAGGGACGAT GTCAACGTAC TAATTCAGCT GGACCAGGGG GGCCGGGAGG GCCCCGTGCC CCAACCCCAG GCTCAGGGTC TGGCCGAGAA GATCCGAGCC TGCTGCTACC TTGAGTGCTC AGCCTTGACG CAGAAGAACT TGAAGGAAGT ATTTGACTCG GCTATTCTCA GTGCCATTGA GCACAAAGCC CGGCTGGAGA AGAAACTGAA TGCCAAAGGT GTGCGCACCC TCTCCCGCTG CCGCTGGAAG AAGTTCTTCT GCTTCGTTTG A. It is sometimes possible for the material contained within the vial of "RHOV, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
