Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

RHOQ cdna clone

RHOQ cDNA Clone

Gene Names
RHOQ; ARHQ; TC10; TC10A; RASL7A; HEL-S-42
Synonyms
RHOQ; RHOQ cDNA Clone; RHOQ cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
ATGGCTCACGGGCCCGGCGCGCTGATGCTCAAGTGCGTGGTGGTCGGCGACGGGGCGGTGGGCAAGACGTGCCTACTCATGAGCTATGCCAACGACGCCTTCCCGGAGGAGTACGTGCCCACCGTCTTCGACCACTACGCAGTCAGCGTCACCGTGGGGGGCAAGCAGTACCTCCTAGGACTCTATGACACGGCCGGACAGGAAGACTATGACCGTCTGAGGCCTTTATCTTACCCAATGACCGATGTCTTCCTTATATGCTTCTCGGTGGTAAATCCAGCCTCATTTCAAAATGTGAAAGAGGAGTGGGTACCGGAACTTAAGGAATACGCACCAAATGTACCCTTTTTATTAATAGGAACTCAGATTGATCTCCGAGATGACCCCAAAACTTTAGCAAGACTGAATGATATGAAAGAAAAACCTATATGTGTGGAACAAGGACAGAAACTAGCAAAAGAGATAGGAGCATGCTGCTATGTGGAATGTTCAGCTTTAACCCAGAAGGGATTGAAGACTGTTTTTGATGAGGCTATCATAGCCATTTTAACTCCAAAGAAACACACTGTAAAAAAAAGAATAGGATCAAGATGTATAAACTGTTGTTTAATTACGTGA
Sequence Length
618
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,659 Da
NCBI Official Full Name
Homo sapiens ras homolog gene family, member Q, mRNA
NCBI Official Synonym Full Names
ras homolog family member Q
NCBI Official Symbol
RHOQ
NCBI Official Synonym Symbols
ARHQ; TC10; TC10A; RASL7A; HEL-S-42
NCBI Protein Information
rho-related GTP-binding protein RhoQ
UniProt Protein Name
Rho-related GTP-binding protein RhoQ
UniProt Gene Name
RHOQ
UniProt Synonym Gene Names
ARHQ; RASL7A; TC10
UniProt Entry Name
RHOQ_HUMAN

NCBI Description

This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The encoded protein is an important signalling protein for sarcomere assembly and has been shown to play a significant role in the exocytosis of the solute carrier family 2, facilitated glucose transporter member 4 and other proteins, possibly acting as the signal that turns on the membrane fusion machinery. Three related pseudogene have been identified on chromosomes 2 and 14. [provided by RefSeq, Aug 2011]

Uniprot Description

RHOQ: Plasma membrane-associated small GTPase which cycles between an active GTP-bound and an inactive GDP-bound state. In active state binds to a variety of effector proteins to regulate cellular responses. Involved in epithelial cell polarization processes. May play a role in CFTR trafficking to the plasma membrane. Causes the formation of thin, actin-rich surface projections called filopodia. Belongs to the small GTPase superfamily. Rho family.

Protein type: G protein, monomeric; G protein; Motility/polarity/chemotaxis; G protein, monomeric, Rho

Chromosomal Location of Human Ortholog: 2p21

Cellular Component: actin filament; cytosol; plasma membrane

Molecular Function: GBD domain binding; GTPase activity; profilin binding

Biological Process: cellular response to insulin stimulus; cortical actin cytoskeleton organization and biogenesis; GTP metabolic process; insulin receptor signaling pathway; positive regulation of filopodium formation; positive regulation of glucose import; positive regulation of transcription from RNA polymerase II promoter; regulation of actin cytoskeleton organization and biogenesis; regulation of small GTPase mediated signal transduction

Research Articles on RHOQ

Similar Products

Product Notes

The RHOQ rhoq (Catalog #AAA1276587) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGCTCACG GGCCCGGCGC GCTGATGCTC AAGTGCGTGG TGGTCGGCGA CGGGGCGGTG GGCAAGACGT GCCTACTCAT GAGCTATGCC AACGACGCCT TCCCGGAGGA GTACGTGCCC ACCGTCTTCG ACCACTACGC AGTCAGCGTC ACCGTGGGGG GCAAGCAGTA CCTCCTAGGA CTCTATGACA CGGCCGGACA GGAAGACTAT GACCGTCTGA GGCCTTTATC TTACCCAATG ACCGATGTCT TCCTTATATG CTTCTCGGTG GTAAATCCAG CCTCATTTCA AAATGTGAAA GAGGAGTGGG TACCGGAACT TAAGGAATAC GCACCAAATG TACCCTTTTT ATTAATAGGA ACTCAGATTG ATCTCCGAGA TGACCCCAAA ACTTTAGCAA GACTGAATGA TATGAAAGAA AAACCTATAT GTGTGGAACA AGGACAGAAA CTAGCAAAAG AGATAGGAGC ATGCTGCTAT GTGGAATGTT CAGCTTTAAC CCAGAAGGGA TTGAAGACTG TTTTTGATGA GGCTATCATA GCCATTTTAA CTCCAAAGAA ACACACTGTA AAAAAAAGAA TAGGATCAAG ATGTATAAAC TGTTGTTTAA TTACGTGA. It is sometimes possible for the material contained within the vial of "RHOQ, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual