RHOQ cdna clone

RHOQ cDNA Clone

Cat. Num. AAA1276587

• Gene Names: RHOQ; ARHQ; TC10; TC10A; RASL7A; HEL-S-42
• Synonyms: RHOQ; RHOQ cDNA Clone; RHOQ cdna clone

• Sequence: ATGGCTCACGGGCCCGGCGCGCTGATGCTCAAGTGCGTGGTGGTCGGCGACGGGGCGGTGGGCAAGACGTGCCTACTCATGAGCTATGCCAACGACGCCTTCCCGGAGGAGTACGTGCCCACCGTCTTCGACCACTACGCAGTCAGCGTCACCGTGGGGGGCAAGCAGTACCTCCTAGGACTCTATGACACGGCCGGACAGGAAGACTATGACCGTCTGAGGCCTTTATCTTACCCAATGACCGATGTCTTCCTTATATGCTTCTCGGTGGTAAATCCAGCCTCATTTCAAAATGTGAAAGAGGAGTGGGTACCGGAACTTAAGGAATACGCACCAAATGTACCCTTTTTATTAATAGGAACTCAGATTGATCTCCGAGATGACCCCAAAACTTTAGCAAGACTGAATGATATGAAAGAAAAACCTATATGTGTGGAACAAGGACAGAAACTAGCAAAAGAGATAGGAGCATGCTGCTATGTGGAATGTTCAGCTTTAACCCAGAAGGGATTGAAGACTGTTTTTGATGAGGCTATCATAGCCATTTTAACTCCAAAGAAACACACTGTAAAAAAAAGAATAGGATCAAGATGTATAAACTGTTGTTTAATTACGTGA
• Sequence Length: 618

• Vector: pENTR223.1
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 33440525
• NCBI GeneID: 23433
• Molecular Weight: 22,659 Da
• NCBI Official Full Name: Homo sapiens ras homolog gene family, member Q, mRNA
• NCBI Official Synonym Full Names: ras homolog family member Q
• NCBI Official Symbol: RHOQ
• NCBI Official Synonym Symbols: ARHQ; TC10; TC10A; RASL7A; HEL-S-42
• NCBI Protein Information: rho-related GTP-binding protein RhoQ
• UniProt Protein Name: Rho-related GTP-binding protein RhoQ
• Protein Family: Rho-related GTP-binding protein
• UniProt Gene Name: RHOQ
• UniProt Synonym Gene Names: ARHQ; RASL7A; TC10
• UniProt Entry Name: RHOQ_HUMAN

NCBI Description

This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The encoded protein is an important signalling protein for sarcomere assembly and has been shown to play a significant role in the exocytosis of the solute carrier family 2, facilitated glucose transporter member 4 and other proteins, possibly acting as the signal that turns on the membrane fusion machinery. Three related pseudogene have been identified on chromosomes 2 and 14. [provided by RefSeq, Aug 2011]

Uniprot Description

RHOQ: Plasma membrane-associated small GTPase which cycles between an active GTP-bound and an inactive GDP-bound state. In active state binds to a variety of effector proteins to regulate cellular responses. Involved in epithelial cell polarization processes. May play a role in CFTR trafficking to the plasma membrane. Causes the formation of thin, actin-rich surface projections called filopodia. Belongs to the small GTPase superfamily. Rho family.

Protein type: G protein, monomeric; G protein; Motility/polarity/chemotaxis; G protein, monomeric, Rho

Chromosomal Location of Human Ortholog: 2p21

Cellular Component: actin filament; cytosol; plasma membrane

Molecular Function: GBD domain binding; GTPase activity; profilin binding

Biological Process: cellular response to insulin stimulus; cortical actin cytoskeleton organization and biogenesis; GTP metabolic process; insulin receptor signaling pathway; positive regulation of filopodium formation; positive regulation of glucose import; positive regulation of transcription from RNA polymerase II promoter; regulation of actin cytoskeleton organization and biogenesis; regulation of small GTPase mediated signal transduction