Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RGS9 cdna clone

RGS9 cDNA Clone

Gene Names
RGS9; PERRS; RGS9L
Synonyms
RGS9; RGS9 cDNA Clone; RGS9 cdna clone
Ordering
For Research Use Only!
Sequence
atgtattaccaacaggccttgatgaggtccacagtgaagtcttctgtgtccctgggagggattgtgaaatacagtgagcagttctcatccaacgatgccatcatgtcaggctgcctccccagcaacccctggatcaccgatgacacccagttctgggacttaaatgccaaattggtggaaatcccaaccaagatgcgagtggaacgatgggccttcaacttcagcgaattgatccgagaccccaaaggtcgacagagcttccagtacttcctcaagaaagaattcagtggagagaatctgggattctgggaagcctgcgaggatctgaagtatggagatcagtccaaagtcaaggagaaagcagaggagatttacaagctgttcctggccccgggggcgaggcgctggatcaacatagatggcaaaaccatggacatcacagtgaaggggctgaagcacccccaccgctatgtgctggacgccgcacaaacccacatttacatgctcatgaagaaggattcttatgctcgctatttaaaatctccgatctataaggacatgctggccaaagctattgaacctcaggaaaccaccaagaaaagctccaccctcccttttatgcggcgtcacctgcgctccagcccaagccctgtcatcctgagacagctggaagaggaagccaaggcccgagaagcagccaacactgtggacatcacccagccgggccagcacatggctcccagcccccatctgaccgtgtacaccgggacctgcatgcccccgtctccttctagccccttctcctcctcctgccgctcccccaggaagcctttcgcctcacccagccgcttcatccggcgacccagcaccaccatctgcccctcacccatcagagtggccttggagagctcatcgggcttggagcagaaaggggagtgcagcgggtccatggccccccgtgggccctctgtcaccgagagcagcgaggcctccctcgacacctcctggcctcgcagccggcccagggcccctcctaaggcccgcatggctctgtccttcagcaggtttctgagacgaggctgtctggcctcacctgtctttgccaggctctcacccaagtgccctgctgtgtcccacgggagggtgcagcccctgggggacgtgggccagcagctgccacgattgaaatccaagagagtagcaaactttttccagatcaaaatggatgtgcccacggggagcgggacctgcttgatggactcggaggatgctggaacaggagagtcgggtgaccgggccacagaaaaggaggtcatctgcccctgggagagcctgtaa
Sequence Length
1338
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
76,625 Da
NCBI Official Full Name
Homo sapiens regulator of G-protein signaling 9, mRNA
NCBI Official Synonym Full Names
regulator of G-protein signaling 9
NCBI Official Symbol
RGS9
NCBI Official Synonym Symbols
PERRS; RGS9L
NCBI Protein Information
regulator of G-protein signaling 9
UniProt Protein Name
Regulator of G-protein signaling 9
UniProt Gene Name
RGS9
UniProt Synonym Gene Names
RGS9
UniProt Entry Name
RGS9_HUMAN

NCBI Description

This gene encodes a member of the RGS family of GTPase activating proteins that function in various signaling pathways by accelerating the deactivation of G proteins. This protein is anchored to photoreceptor membranes in retinal cells and deactivates G proteins in the rod and cone phototransduction cascades. Mutations in this gene result in bradyopsia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]

Uniprot Description

RGS9: belongs to the 'regulator of G protein signaling' family. Inhibits signal transduction by increasing the GTPAse activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Binds to G(t)-alpha. Involved in phototransduction; key element in the recovery phase of visual transduction. Four alternatively spliced isoforms have been described.

Protein type: GAPs, RGS; GAPs

Chromosomal Location of Human Ortholog: 17q24

Cellular Component: cytoplasm; plasma membrane

Biological Process: protein folding

Disease: Prolonged Electroretinal Response Suppression

Research Articles on RGS9

Similar Products

Product Notes

The RGS9 rgs9 (Catalog #AAA1277226) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtattacc aacaggcctt gatgaggtcc acagtgaagt cttctgtgtc cctgggaggg attgtgaaat acagtgagca gttctcatcc aacgatgcca tcatgtcagg ctgcctcccc agcaacccct ggatcaccga tgacacccag ttctgggact taaatgccaa attggtggaa atcccaacca agatgcgagt ggaacgatgg gccttcaact tcagcgaatt gatccgagac cccaaaggtc gacagagctt ccagtacttc ctcaagaaag aattcagtgg agagaatctg ggattctggg aagcctgcga ggatctgaag tatggagatc agtccaaagt caaggagaaa gcagaggaga tttacaagct gttcctggcc ccgggggcga ggcgctggat caacatagat ggcaaaacca tggacatcac agtgaagggg ctgaagcacc cccaccgcta tgtgctggac gccgcacaaa cccacattta catgctcatg aagaaggatt cttatgctcg ctatttaaaa tctccgatct ataaggacat gctggccaaa gctattgaac ctcaggaaac caccaagaaa agctccaccc tcccttttat gcggcgtcac ctgcgctcca gcccaagccc tgtcatcctg agacagctgg aagaggaagc caaggcccga gaagcagcca acactgtgga catcacccag ccgggccagc acatggctcc cagcccccat ctgaccgtgt acaccgggac ctgcatgccc ccgtctcctt ctagcccctt ctcctcctcc tgccgctccc ccaggaagcc tttcgcctca cccagccgct tcatccggcg acccagcacc accatctgcc cctcacccat cagagtggcc ttggagagct catcgggctt ggagcagaaa ggggagtgca gcgggtccat ggccccccgt gggccctctg tcaccgagag cagcgaggcc tccctcgaca cctcctggcc tcgcagccgg cccagggccc ctcctaaggc ccgcatggct ctgtccttca gcaggtttct gagacgaggc tgtctggcct cacctgtctt tgccaggctc tcacccaagt gccctgctgt gtcccacggg agggtgcagc ccctggggga cgtgggccag cagctgccac gattgaaatc caagagagta gcaaactttt tccagatcaa aatggatgtg cccacgggga gcgggacctg cttgatggac tcggaggatg ctggaacagg agagtcgggt gaccgggcca cagaaaagga ggtcatctgc ccctgggaga gcctgtaa. It is sometimes possible for the material contained within the vial of "RGS9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.