Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RGS8 cdna clone

RGS8 cDNA Clone

Synonyms
RGS8; RGS8 cDNA Clone; RGS8 cdna clone
Ordering
For Research Use Only!
Sequence
atgtggaacaccttaacccgaagcctctctgaccatccagttggcaaagaccctcaggccatgaggactggccaaagacagaacaaagggatgaggactcgactgggatgcctgtctcacaagtcagactcgtgtagtgatttcacagctattcttccagacaaacccaaccgcgctctcaagagattatcgacagaagaagctacgaggtgggcagattcctttgatgtgcttctctctcataagtatggggtggctgcattccgtgccttcttgaagacggagttcagtgaggagaacctggaattctggttggcctgtgaggagttcaagaagaccaggtccactgcaaaactggtctctaaggcccataggatctttgaggagtttgtggatgtgcaggctccacgggaggtaaacattgacttccagacccgagaagccacgaggaagaacctgcaggagccatccctgacttgctttgaccaagcccaaggaaaagtacacagcctcatggagaaagactcttaccccaggttcctgaggtccaaaatgtacttagatctgctgtcccaaagccagaggaggctcagttag
Sequence Length
597
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,970 Da
NCBI Official Full Name
Homo sapiens regulator of G-protein signaling 8, mRNA
NCBI Official Synonym Full Names
regulator of G-protein signaling 8
NCBI Official Symbol
RGS8
NCBI Protein Information
regulator of G-protein signaling 8
UniProt Protein Name
Regulator of G-protein signaling 8
UniProt Gene Name
RGS8
UniProt Synonym Gene Names
RGS8
UniProt Entry Name
RGS8_HUMAN

NCBI Description

This gene is a member of the regulator of G protein signaling (RGS) family and encodes a protein with a single RGS domain. Regulator of G protein signaling (RGS) proteins are regulatory and structural components of G protein-coupled receptor complexes. They accelerate transit through the cycle of GTP binding and hydrolysis to GDP, thereby terminating signal transduction, but paradoxically, also accelerate receptor-stimulated activation. [provided by RefSeq, Jul 2008]

Uniprot Description

RGS8: Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Preferentially binds to G(o)-alpha and G(i)-alpha-3. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 1q25

Cellular Component: cytoplasm; dendrite; extrinsic to internal side of plasma membrane; nucleus; plasma membrane

Molecular Function: GTPase activator activity; protein binding

Biological Process: acetylcholine receptor signaling, muscarinic pathway; positive regulation of GTPase activity; regulation of dopamine receptor signaling pathway

Research Articles on RGS8

Similar Products

Product Notes

The RGS8 rgs8 (Catalog #AAA1269606) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggaaca ccttaacccg aagcctctct gaccatccag ttggcaaaga ccctcaggcc atgaggactg gccaaagaca gaacaaaggg atgaggactc gactgggatg cctgtctcac aagtcagact cgtgtagtga tttcacagct attcttccag acaaacccaa ccgcgctctc aagagattat cgacagaaga agctacgagg tgggcagatt cctttgatgt gcttctctct cataagtatg gggtggctgc attccgtgcc ttcttgaaga cggagttcag tgaggagaac ctggaattct ggttggcctg tgaggagttc aagaagacca ggtccactgc aaaactggtc tctaaggccc ataggatctt tgaggagttt gtggatgtgc aggctccacg ggaggtaaac attgacttcc agacccgaga agccacgagg aagaacctgc aggagccatc cctgacttgc tttgaccaag cccaaggaaa agtacacagc ctcatggaga aagactctta ccccaggttc ctgaggtcca aaatgtactt agatctgctg tcccaaagcc agaggaggct cagttag. It is sometimes possible for the material contained within the vial of "RGS8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.