Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RGS20 cdna clone

RGS20 cDNA Clone

Gene Names
RGS20; RGSZ1; ZGAP1; gz-GAP; g(z)GAP
Synonyms
RGS20; RGS20 cDNA Clone; RGS20 cdna clone
Ordering
For Research Use Only!
Sequence
atgggatcagagcggatggagatgcggaagcggcagatgcccgccgcccaggacacaccaggcgccgccccaggccagcccggagcggggagtcgcgggtccaacgcatgctgcttctgctggtgctgctgttgtagctgctcgtgtctcactgttagaaaccaggaagatcagaggcccacaatagcttcccacgaactcagagcagatcttccaacctgggaagaaagccctgctcctactctggaagaagtcaacgcctgggctcagtcatttgacaaattaatggtcactccagcaggaaggaatgcattccgtgaattcctccgaacagaattcagtgaggaaaatatgctcttctggatggcctgtgaggaactgaaaaaggaagctaataaaaacattattgaagagaaagcaaggataatctatgaagactacatttctatactttctcctaaggaggtgagcttagactcccgggtgagagaagtgatcaacagaaacatggtggagccatcccaacacatattcgatgatgctcaacttcagatttacaccctgatgcacagagactcatatcctcgattcatgaactctgctgtctataaggacttgcttcagtccttatcggagaaatctattgaagcatag
Sequence Length
654
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,060 Da
NCBI Official Full Name
Homo sapiens regulator of G-protein signaling 20, mRNA
NCBI Official Synonym Full Names
regulator of G-protein signaling 20
NCBI Official Symbol
RGS20
NCBI Official Synonym Symbols
RGSZ1; ZGAP1; gz-GAP; g(z)GAP
NCBI Protein Information
regulator of G-protein signaling 20
UniProt Protein Name
Regulator of G-protein signaling 20
UniProt Gene Name
RGS20
UniProt Synonym Gene Names
RGSZ1; ZGAP1; RGS20; G(z)GAP; Gz-GAP
UniProt Entry Name
RGS20_HUMAN

NCBI Description

The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]

Uniprot Description

RGS20: Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Binds selectively to G(z)-alpha and G(alpha)-i2 subunits, accelerates their GTPase activity and regulates their signaling activities. The G(z)-alpha activity is inhibited by the phosphorylation and palmitoylation of the G- protein. Negatively regulates mu-opioid receptor-mediated activation of the G-proteins. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: GAPs; GAPs, misc.

Chromosomal Location of Human Ortholog: 8q11.23

Cellular Component: beta-catenin destruction complex; cell cortex; cytoplasm; cytoplasmic membrane-bound vesicle; cytoplasmic microtubule; plasma membrane; postsynaptic density; trans-Golgi network

Molecular Function: beta-catenin binding; GTPase activator activity; protein binding; protein kinase binding

Biological Process: cell death; cell differentiation; dorsal/ventral axis specification; regulation of G-protein coupled receptor protein signaling pathway; regulation of transcription, DNA-dependent

Research Articles on RGS20

Similar Products

Product Notes

The RGS20 rgs20 (Catalog #AAA1270678) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggatcag agcggatgga gatgcggaag cggcagatgc ccgccgccca ggacacacca ggcgccgccc caggccagcc cggagcgggg agtcgcgggt ccaacgcatg ctgcttctgc tggtgctgct gttgtagctg ctcgtgtctc actgttagaa accaggaaga tcagaggccc acaatagctt cccacgaact cagagcagat cttccaacct gggaagaaag ccctgctcct actctggaag aagtcaacgc ctgggctcag tcatttgaca aattaatggt cactccagca ggaaggaatg cattccgtga attcctccga acagaattca gtgaggaaaa tatgctcttc tggatggcct gtgaggaact gaaaaaggaa gctaataaaa acattattga agagaaagca aggataatct atgaagacta catttctata ctttctccta aggaggtgag cttagactcc cgggtgagag aagtgatcaa cagaaacatg gtggagccat cccaacacat attcgatgat gctcaacttc agatttacac cctgatgcac agagactcat atcctcgatt catgaactct gctgtctata aggacttgct tcagtcctta tcggagaaat ctattgaagc atag. It is sometimes possible for the material contained within the vial of "RGS20, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.