RGP1 cdna clone
RGP1 cDNA Clone
Gene Names
RGP1; KIAA0258
Synonyms
RGP1; RGP1 cDNA Clone; RGP1 cdna clone
Sequence
atgattgaagtggtagcagagctcagccggggtcctgtatttttggctggggaggcgctggagtgtgtagtgaccgtcaccaacccccttccgcccacggccacttctgcatccagtgaggccctggcctgggccagtgcccaaatccactgccagttccatgccagtgagagtcgagtagcactgcctcctcctgactctagtcagccagatgtccagcccgacagccagactgtctttctgccacaccgaggtgagaggggccagtgtatcctttctactccaccgaaaattctattctgtgacctgaggcttgatcctggagagtccaaatcatactcctacagtgaagtgctgcccatagagggaccaccctcctttcggggtcagtcagtcaagtacgtctacaaactgaccattggctgccagcgtgtcaactcccctatcactttactcagagtccctctgagggttcttgtgctgactggccttcaggatgtccggtttccccaggatgaggctgtagccccatccagtccattcttggaggaggatgaaggtgggaagaaagattcatggctagctgagctggctggggaacgcctaatggctgccacatcctgccgcagcctccatctatacaatatcagtgatggccgagggaaagttgggacgtttggcatcttcaaatctgtgtacagacttggcgaggacgtggtggggaccttaaacttaggggaaggaaccgtagcttgtttgcagttttcagtcagcttacagaccgaggagcgtgtacagcctgagtaccagcggcgacgtggggcagggggtgtcccctctgtgtcacatgtgactcacgcccggcaccaggaatcctgcctacatacaactagaaccagcttctccctcccaatccctctcagctccaccccaggcttctgtacagccattgtgtccttgaagtggagattgcattttgaatttgtaacgtcccgagaaccaggattggtactcctaccccctgtggaacagcccgaacctaccacctggacaggacctgagcaagtacctgtagacaccttcagctgggacctgcccatcaaggtgctgcctactagccccaccctggcctcatatgctgccccaggccccagcaccagcaccataaccatctga
Sequence Length
1176
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
42,455 Da
NCBI Official Full Name
Homo sapiens RGP1 retrograde golgi transport homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
RGP1 homolog, RAB6A GEF complex partner 1
NCBI Official Symbol
RGP1
NCBI Official Synonym Symbols
KIAA0258
NCBI Protein Information
RAB6A-GEF complex partner protein 2
UniProt Protein Name
RAB6A-GEF complex partner protein 2
Protein Family
UniProt Gene Name
RGP1
UniProt Entry Name
RGP1_HUMAN
Uniprot Description
RGP1: Belongs to the RGP1 family.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 9p13.3
Cellular Component: cytosol; Golgi membrane; membrane; protein complex; trans-Golgi network membrane
Molecular Function: protein binding; Rab GTPase binding; Rab guanyl-nucleotide exchange factor activity
Biological Process: positive regulation of GTPase activity; retrograde transport, endosome to Golgi
Research Articles on RGP1
Similar Products
Product Notes
The RGP1 rgp1 (Catalog #AAA1277906) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattgaag tggtagcaga gctcagccgg ggtcctgtat ttttggctgg ggaggcgctg gagtgtgtag tgaccgtcac caaccccctt ccgcccacgg ccacttctgc atccagtgag gccctggcct gggccagtgc ccaaatccac tgccagttcc atgccagtga gagtcgagta gcactgcctc ctcctgactc tagtcagcca gatgtccagc ccgacagcca gactgtcttt ctgccacacc gaggtgagag gggccagtgt atcctttcta ctccaccgaa aattctattc tgtgacctga ggcttgatcc tggagagtcc aaatcatact cctacagtga agtgctgccc atagagggac caccctcctt tcggggtcag tcagtcaagt acgtctacaa actgaccatt ggctgccagc gtgtcaactc ccctatcact ttactcagag tccctctgag ggttcttgtg ctgactggcc ttcaggatgt ccggtttccc caggatgagg ctgtagcccc atccagtcca ttcttggagg aggatgaagg tgggaagaaa gattcatggc tagctgagct ggctggggaa cgcctaatgg ctgccacatc ctgccgcagc ctccatctat acaatatcag tgatggccga gggaaagttg ggacgtttgg catcttcaaa tctgtgtaca gacttggcga ggacgtggtg gggaccttaa acttagggga aggaaccgta gcttgtttgc agttttcagt cagcttacag accgaggagc gtgtacagcc tgagtaccag cggcgacgtg gggcaggggg tgtcccctct gtgtcacatg tgactcacgc ccggcaccag gaatcctgcc tacatacaac tagaaccagc ttctccctcc caatccctct cagctccacc ccaggcttct gtacagccat tgtgtccttg aagtggagat tgcattttga atttgtaacg tcccgagaac caggattggt actcctaccc cctgtggaac agcccgaacc taccacctgg acaggacctg agcaagtacc tgtagacacc ttcagctggg acctgcccat caaggtgctg cctactagcc ccaccctggc ctcatatgct gccccaggcc ccagcaccag caccataacc atctga. It is sometimes possible for the material contained within the vial of "RGP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
