RGNEF cdna clone
RGNEF cDNA Clone
Gene Names
ARHGEF28; RIP2; RGNEF; p190RHOGEF
Synonyms
RGNEF; RGNEF cDNA Clone; RGNEF cdna clone
Sequence
atgattgcaacagtggatttaaaagtcaatgaatatgagaaaaaccaaaaatggcttgagatcctaaataagattgaaaacaaaacatacacgaagctcaaaaatggacatgtgtttaggaagcaggcactgatgagtgaagaaaggactctgttatatgatggccttgtttactggaaaactgctacaggtcgtttcaaagatatcctagctctacttctaactgatgtgctgctctttttacaagaaaaagaccagaaatacatctttgcagccgttgatcagaagccatcagttatttcccttcaaaagcttattgctagagaagttgctaatgaggagagaggaatgtttctgatcagtgcttcatctgctggtcctgagatgtatgaaattcacaccaattccaaggaggaacgcaataactggatgagacggatccagcaggctgtagaaagttgtcctgaagaaaaagggggaaggacaagtgaatctgatgaagacaagaggaaagctgaagccagagtggccaaaattcagcaatgtcaagaaatactcactaaccaagaccaacaaatttgtgcgtatttggaggagaagctgcatatctatgctgaacttggagaactgagcggatttgaggacgtccatctagagccccacctccttattaaacctgacccaggcgagcctccccaggcagcctcattactggcagcagcactgaaagaagctgagagcctacaagttgcagtgaaggcctcacagatgggcgccgtgagtcaatcatgtgaggacagttgtggagactctgtcttggcggacacactcagttctcatgatgtaccaggatcaccgactgcctcattagtcacaggagggagagaaggaagaggctgttcggatgtggatcccgggatccagggtgtggtaaccgacttggccgtctctgatgcaggggagaaggtggaatgtagaaattttccaggttcttcacaatcagagattatacaagccatacagaatttaacccgtctcttatacagccttcaggccgccttgaccattcaggacagccacattgagatccacaggctggttctccagcagcaggagggcctgtctctcggccactctatcctccgaggcggccccttgcaggaccagaagtctcgcgacgcggacaggcagcatgaggagctggccaatgtgcaccagcttcagcaccagctccagcaggagcagcggcgctggctgcgcaggtgtgagcagcagcagcgggcgcaggcgaccagggagagctggctgcaggagcgggagcgggagtgccagtcgcaggaggagctgctgctgcggagccggggcgagctggacctccagctccaggagtaccagcacagcctggagcggctgagggagggccagcgcctggtggagagggagcaggcgaggatgcgggcccagcagagcctgctgggccactggaagcacggccggcagaggagcctgcccgcggtgctccttccgggtggccccgaggtaatggaacttaaccgatctgagagtttatgtcatgaaaactcattcttcatcaatgaagctttagtacaaatgtcatttaacactttcaacaaactgaatccatcagttatccatcaggatgccacttaccctacaactcaatttcattctgacttggtgaggactagtgaacatcaagtagacctcctggtggacccttctcagcctttgaatgtcagtcacaaactgtggacagccgctggttccggccatcagatacttcctttccatgaaagcagcaaggattcttgtaaaaatggtaattaa
Sequence Length
1848
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
194,519 Da
NCBI Official Full Name
Homo sapiens Rho-guanine nucleotide exchange factor, mRNA
NCBI Official Synonym Full Names
Rho guanine nucleotide exchange factor 28
NCBI Official Symbol
ARHGEF28
NCBI Official Synonym Symbols
RIP2; RGNEF; p190RHOGEF
NCBI Protein Information
rho guanine nucleotide exchange factor 28
UniProt Protein Name
Rho guanine nucleotide exchange factor 28
UniProt Gene Name
ARHGEF28
UniProt Synonym Gene Names
KIAA1998; RGNEF; p190-RhoGEF; p190RhoGEF
UniProt Entry Name
ARG28_HUMAN
NCBI Description
This gene encodes a member of the Rho guanine nucleotide exchange factor family. The encoded protein interacts with low molecular weight neurofilament mRNA and may be involved in the formation of amyotrophic lateral sclerosis neurofilament aggregates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
Uniprot Description
RGNEF: Functions as a RHOA-specific guanine nucleotide exchange factor regulating signaling pathways downstream of integrins and growth factor receptors. Functions in axonal branching, synapse formation and dendritic morphogenesis. Functions also in focal adhesion formation, cell motility and B-lymphocytes activation. May regulate NEFL expression and aggregation and play a role in apoptosis. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: GEFs; Cell development/differentiation; GEFs, Rac/Rho; Motility/polarity/chemotaxis
Chromosomal Location of Human Ortholog: 5q13.2
Cellular Component: cytosol
Molecular Function: guanyl-nucleotide exchange factor activity
Biological Process: ephrin receptor signaling pathway
Research Articles on RGNEF
Similar Products
Product Notes
The RGNEF arhgef28 (Catalog #AAA1272434) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattgcaa cagtggattt aaaagtcaat gaatatgaga aaaaccaaaa atggcttgag atcctaaata agattgaaaa caaaacatac acgaagctca aaaatggaca tgtgtttagg aagcaggcac tgatgagtga agaaaggact ctgttatatg atggccttgt ttactggaaa actgctacag gtcgtttcaa agatatccta gctctacttc taactgatgt gctgctcttt ttacaagaaa aagaccagaa atacatcttt gcagccgttg atcagaagcc atcagttatt tcccttcaaa agcttattgc tagagaagtt gctaatgagg agagaggaat gtttctgatc agtgcttcat ctgctggtcc tgagatgtat gaaattcaca ccaattccaa ggaggaacgc aataactgga tgagacggat ccagcaggct gtagaaagtt gtcctgaaga aaaaggggga aggacaagtg aatctgatga agacaagagg aaagctgaag ccagagtggc caaaattcag caatgtcaag aaatactcac taaccaagac caacaaattt gtgcgtattt ggaggagaag ctgcatatct atgctgaact tggagaactg agcggatttg aggacgtcca tctagagccc cacctcctta ttaaacctga cccaggcgag cctccccagg cagcctcatt actggcagca gcactgaaag aagctgagag cctacaagtt gcagtgaagg cctcacagat gggcgccgtg agtcaatcat gtgaggacag ttgtggagac tctgtcttgg cggacacact cagttctcat gatgtaccag gatcaccgac tgcctcatta gtcacaggag ggagagaagg aagaggctgt tcggatgtgg atcccgggat ccagggtgtg gtaaccgact tggccgtctc tgatgcaggg gagaaggtgg aatgtagaaa ttttccaggt tcttcacaat cagagattat acaagccata cagaatttaa cccgtctctt atacagcctt caggccgcct tgaccattca ggacagccac attgagatcc acaggctggt tctccagcag caggagggcc tgtctctcgg ccactctatc ctccgaggcg gccccttgca ggaccagaag tctcgcgacg cggacaggca gcatgaggag ctggccaatg tgcaccagct tcagcaccag ctccagcagg agcagcggcg ctggctgcgc aggtgtgagc agcagcagcg ggcgcaggcg accagggaga gctggctgca ggagcgggag cgggagtgcc agtcgcagga ggagctgctg ctgcggagcc ggggcgagct ggacctccag ctccaggagt accagcacag cctggagcgg ctgagggagg gccagcgcct ggtggagagg gagcaggcga ggatgcgggc ccagcagagc ctgctgggcc actggaagca cggccggcag aggagcctgc ccgcggtgct ccttccgggt ggccccgagg taatggaact taaccgatct gagagtttat gtcatgaaaa ctcattcttc atcaatgaag ctttagtaca aatgtcattt aacactttca acaaactgaa tccatcagtt atccatcagg atgccactta ccctacaact caatttcatt ctgacttggt gaggactagt gaacatcaag tagacctcct ggtggaccct tctcagcctt tgaatgtcag tcacaaactg tggacagccg ctggttccgg ccatcagata cttcctttcc atgaaagcag caaggattct tgtaaaaatg gtaattaa. It is sometimes possible for the material contained within the vial of "RGNEF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
