RERG cdna clone

RERG cDNA Clone

Cat. Num. AAA1276566

• Synonyms: RERG; RERG cDNA Clone; RERG cdna clone

• Sequence: atggctaaaagtgcggaggtcaaactggcaatatttgggagagcaggcgtgggcaagtcagctcttgtagtgagatttctgaccaaacggttcatctgggaatatgatcccaccctcgaatcaacctaccgacaccaagcaaccatcgatgatgaagttgtttccatggagatactagacactgctggtcaggaagataccattcagagggaggggcacatgcgatggggggaaggctttgtgctggtctacgacattactgaccgaggaagttttgaggaagtgctgccacttaagaacatcctagatgagatcaaaaagcccaagaatgtgactctcatcttggttggaaacaaagctgacttggaccactccaggcaggttagcacagaagaaggagagaagctggccacagaattggcttgtgctttttacgagtgctctgcctgcactggagaagggaacatcacagagatattctatgaattgtgtcgagaggtgcgtcgccggaggatggtgcagggcaagacgaggcgacgcagctccaccacgcatgtcaagcaagccattaacaagatgctcaccaaaatcagtagttag
• Sequence Length: 600

• Vector: pENTR223.1 or pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 14124945
• NCBI GeneID: 85004
• Molecular Weight: 20,258 Da
• NCBI Official Full Name: Homo sapiens RAS-like, estrogen-regulated, growth inhibitor, mRNA
• NCBI Official Synonym Full Names: RAS like estrogen regulated growth inhibitor
• NCBI Official Symbol: RERG
• NCBI Protein Information: ras-related and estrogen-regulated growth inhibitor
• UniProt Protein Name: Ras-related and estrogen-regulated growth inhibitor
• Protein Family: Ras-related and estrogen-regulated growth inhibitor
• UniProt Gene Name: RERG
• UniProt Entry Name: RERG_HUMAN

NCBI Description

RERG, a member of the RAS superfamily of GTPases, inhibits cell proliferation and tumor formation (Finlin et al., 2001 [PubMed 11533059]).[supplied by OMIM, Mar 2009]

Uniprot Description

RERG: Binds GDP/GTP and possesses intrinsic GTPase activity. Has higher affinity for GDP than for GTP. In cell lines overexpression leads to a reduction in the rate of proliferation, colony formation and in tumorigenic potential. Belongs to the small GTPase superfamily. Ras family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: G protein, monomeric, Ras; G protein; G protein, monomeric

Chromosomal Location of Human Ortholog: 12p12.3

Cellular Component: cytosol; nucleus

Molecular Function: GDP binding; GTPase activity

Biological Process: negative regulation of cell growth; negative regulation of cell proliferation; response to hormone stimulus