Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

RERG cdna clone

RERG cDNA Clone

Synonyms
RERG; RERG cDNA Clone; RERG cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atggctaaaagtgcggaggtcaaactggcaatatttgggagagcaggcgtgggcaagtcagctcttgtagtgagatttctgaccaaacggttcatctgggaatatgatcccaccctcgaatcaacctaccgacaccaagcaaccatcgatgatgaagttgtttccatggagatactagacactgctggtcaggaagataccattcagagggaggggcacatgcgatggggggaaggctttgtgctggtctacgacattactgaccgaggaagttttgaggaagtgctgccacttaagaacatcctagatgagatcaaaaagcccaagaatgtgactctcatcttggttggaaacaaagctgacttggaccactccaggcaggttagcacagaagaaggagagaagctggccacagaattggcttgtgctttttacgagtgctctgcctgcactggagaagggaacatcacagagatattctatgaattgtgtcgagaggtgcgtcgccggaggatggtgcagggcaagacgaggcgacgcagctccaccacgcatgtcaagcaagccattaacaagatgctcaccaaaatcagtagttag
Sequence Length
600
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,258 Da
NCBI Official Full Name
Homo sapiens RAS-like, estrogen-regulated, growth inhibitor, mRNA
NCBI Official Synonym Full Names
RAS like estrogen regulated growth inhibitor
NCBI Official Symbol
RERG
NCBI Protein Information
ras-related and estrogen-regulated growth inhibitor
UniProt Protein Name
Ras-related and estrogen-regulated growth inhibitor
UniProt Gene Name
RERG
UniProt Entry Name
RERG_HUMAN

NCBI Description

RERG, a member of the RAS superfamily of GTPases, inhibits cell proliferation and tumor formation (Finlin et al., 2001 [PubMed 11533059]).[supplied by OMIM, Mar 2009]

Uniprot Description

RERG: Binds GDP/GTP and possesses intrinsic GTPase activity. Has higher affinity for GDP than for GTP. In cell lines overexpression leads to a reduction in the rate of proliferation, colony formation and in tumorigenic potential. Belongs to the small GTPase superfamily. Ras family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: G protein, monomeric, Ras; G protein; G protein, monomeric

Chromosomal Location of Human Ortholog: 12p12.3

Cellular Component: cytosol; nucleus

Molecular Function: GDP binding; GTPase activity

Biological Process: negative regulation of cell growth; negative regulation of cell proliferation; response to hormone stimulus

Research Articles on RERG

Similar Products

Product Notes

The RERG rerg (Catalog #AAA1276566) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctaaaa gtgcggaggt caaactggca atatttggga gagcaggcgt gggcaagtca gctcttgtag tgagatttct gaccaaacgg ttcatctggg aatatgatcc caccctcgaa tcaacctacc gacaccaagc aaccatcgat gatgaagttg tttccatgga gatactagac actgctggtc aggaagatac cattcagagg gaggggcaca tgcgatgggg ggaaggcttt gtgctggtct acgacattac tgaccgagga agttttgagg aagtgctgcc acttaagaac atcctagatg agatcaaaaa gcccaagaat gtgactctca tcttggttgg aaacaaagct gacttggacc actccaggca ggttagcaca gaagaaggag agaagctggc cacagaattg gcttgtgctt tttacgagtg ctctgcctgc actggagaag ggaacatcac agagatattc tatgaattgt gtcgagaggt gcgtcgccgg aggatggtgc agggcaagac gaggcgacgc agctccacca cgcatgtcaa gcaagccatt aacaagatgc tcaccaaaat cagtagttag. It is sometimes possible for the material contained within the vial of "RERG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual